Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15773
Trapped Gene
Dbf4 (ENSMUSG00000002297)
Vector Insertion
Chr 5: 8399813 - 8403079
Public Clones not available
Private Clones OST500167 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000184547 (Chr5:8403080..8403191 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000184547 (Chr5:8403080..8403191 -)
Downstram Exon
ENSMUSE00000184544 (Chr5:8399688..8399812 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000496947 Chr5:8422467..8422680 No primer for this exon
upstream ENSMUSE00000497772 Chr5:8421221..8421393 No primer for this exon
upstream ENSMUSE00000302266 Chr5:8412121..8412300 No primer for this exon
upstream ENSMUSE00000302255 Chr5:8410010..8410060 No primer for this exon
upstream ENSMUSE00000302249 Chr5:8408494..8408563 No primer for this exon
upstream ENSMUSE00000184541 Chr5:8408234..8408310 No primer for this exon
upstream ENSMUSE00000184539 Chr5:8405802..8405838 No primer for this exon
upstream ENSMUSE00000184552 Chr5:8404871..8404916 No primer for this exon
upstream ENSMUSE00000184550 Chr5:8403612..8403740 No primer for this exon
upstream ENSMUSE00000184547 Chr5:8403080..8403191 No primer for this exon

*** Putative Vector Insertion (Chr 5: 8399813 - 8403079) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184544 Chr5:8399688..8399812 No primer for this exon
downstream ENSMUSE00000346405 Chr5:8396973..8398162 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCCACTTGGGATTGGTGT Chr5:8403047..8403067 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCACTTGGGATTGGTGT Chr5:8403047..8403067 60.21 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002297