Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15779
Trapped Gene
BX000432.7 (ENSMUSG00000078564)
Vector Insertion
Chr 11: 121806639 - 121806817
Public Clones not available
Private Clones OST499987 (lexicon) OST352729 (lexicon) OST40426 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668538 (Chr11:121806818..121806944 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTTTGCTGAATCCTTCAC Chr11:121806875..121806894 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668538 (Chr11:121806818..121806944 -)
Downstram Exon
ENSMUSE00000668537 (Chr11:121806578..121806638 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTTTGCTGAATCCTTCAC Chr11:121806875..121806894 59.82 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668539 Chr11:121817941..121818021 GCTGGATTCTGTGGACTGTG Chr11:121817970..121817989 59.26 55
upstream ENSMUSE00000668538 Chr11:121806818..121806944 GGCTTTGCTGAATCCTTCAC Chr11:121806875..121806894 59.82 50

*** Putative Vector Insertion (Chr 11: 121806639 - 121806817) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000668537 Chr11:121806578..121806638 No primer for this exon
downstream ENSMUSE00000668536 Chr11:121803725..121805453 GCTTTGCCACATTGGTTACA Chr11:121803776..121803795 59.59 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:121806746..121806766 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078564