Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1578
Trapped Gene
Ppm1g (ENSMUSG00000029147)
Vector Insertion
Chr 5: 31510830 - 31522675
Public Clones (sanger) CC0094 (sanger) NPX363 (baygenomics) IST14789C5 (tigm) IST12028H1 (tigm)
IST14789C5 (tigm)
Private Clones OST253445 (lexicon) OST147995 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000343992 (Chr5:31522676..31522918 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGGGTGCCTACCTCTCTC Chr5:31522777..31522796 59.68 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000343992 (Chr5:31522676..31522918 -)
Downstram Exon
ENSMUSE00000186202 (Chr5:31510760..31510829 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGGGTGCCTACCTCTCTC Chr5:31522777..31522796 59.68 60 CATGGCTGTCTCATTGTCCA Chr5:31510763..31510782 60.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000343992 Chr5:31522676..31522918 CATGGGTGCCTACCTCTCTC Chr5:31522777..31522796 59.68 60

*** Putative Vector Insertion (Chr 5: 31510830 - 31522675) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186202 Chr5:31510760..31510829 CATGGCTGTCTCATTGTCCA Chr5:31510763..31510782 60.69 50
downstream ENSMUSE00000186193 Chr5:31510386..31510471 GGCACAGTACAAGGCAACCT Chr5:31510424..31510443 60.18 55
downstream ENSMUSE00000186190 Chr5:31509936..31510068 CAATCTGGGCCAGTTCCTTA Chr5:31509971..31509990 60.07 50
downstream ENSMUSE00000186194 Chr5:31508411..31508826 AGCAGTACCGGGCTCACTAA Chr5:31508515..31508534 59.9 55
downstream ENSMUSE00000186189 Chr5:31507371..31507502 CTCGTTCTCTGCCTCCTCAC Chr5:31507430..31507449 60.13 60
downstream ENSMUSE00000186188 Chr5:31506826..31507060 CTCCATTGACTCGTCCATCC Chr5:31506828..31506847 60.47 55
downstream ENSMUSE00000186196 Chr5:31506403..31506532 CAGCACCTTGATGTCAGGAA Chr5:31506431..31506450 59.83 50
downstream ENSMUSE00000269838 Chr5:31505945..31506047 CTACAACCTCCTGGCTGCTC Chr5:31505997..31506016 60.01 60
downstream ENSMUSE00000377771 Chr5:31505043..31505657 TGATGATGCACGTCATGTTG Chr5:31505563..31505582 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTGGAACCGCTACCTAAA Chr5:31522649..31522669 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTGGAGAGTTGGGATGTTA Chr5:31522701..31522723 59.47 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGATTTTAATCGCCTTGCAG Chr5:31522854..31522874 58.91 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATTTCGTGACTGGGAAAACC Chr5:31522852..31522872 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029147