Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15792
Trapped Gene
2900024C23Rik (ENSMUSG00000029270)
Vector Insertion
Chr 5: 108353739 - 108415967
Public Clones IST14271A7 (tigm) IST13501A12 (tigm) IST14159A6 (tigm) IST14701E3 (tigm)
Private Clones OST473165 (lexicon) OST448607 (lexicon) OST439346 (lexicon) OST434065 (lexicon)
OST433495 (lexicon) OST401965 (lexicon) OST311922 (lexicon) OST311580 (lexicon)
OST301994 (lexicon) OST301564 (lexicon) OST276962 (lexicon) OST248688 (lexicon)
OST144403 (lexicon) OST123902 (lexicon) OST110981 (lexicon) OST90943 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692520 (Chr5:108415968..108416052 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGAGGAAACCCCATTACC Chr5:108415973..108415992 60.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692520 (Chr5:108415968..108416052 -)
Downstram Exon
ENSMUSE00000387100 (Chr5:108353604..108353738 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGAGGAAACCCCATTACC Chr5:108415973..108415992 60.69 55 ACTTCACCCGCATGTAGGAC Chr5:108353689..108353708 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692520 Chr5:108415968..108416052 GCTGAGGAAACCCCATTACC Chr5:108415973..108415992 60.69 55

*** Putative Vector Insertion (Chr 5: 108353739 - 108415967) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000387100 Chr5:108353604..108353738 ACTTCACCCGCATGTAGGAC Chr5:108353689..108353708 60 55
downstream ENSMUSE00000187529 Chr5:108343365..108343472 GGGCTTGTTGGACAGACATT Chr5:108343352..108343371 59.97 50
downstream ENSMUSE00000187533 Chr5:108340631..108340807 CTTGGCTCCAATTCAGTTCC Chr5:108340691..108340710 59.67 50
downstream ENSMUSE00000651428 Chr5:108337357..108339235 GGGGTGTCTAGGACGTTTCA Chr5:108337479..108337498 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:108355897..108355917 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTCTACCTTCCTCCGTGA Chr5:108391911..108391932 59.72 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGGTCCTCATCCACTTAGC Chr5:108392053..108392073 60.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGGTCCTCATCCACTTAGC Chr5:108392053..108392073 60.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029270