Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15795
Trapped Gene
Fbxo6 (ENSMUSG00000055401)
Vector Insertion
Chr 4: 147523776 - 147525722
Public Clones IST14230G1 (tigm) IST10793H4 (tigm) IST14696G10 (tigm)
Private Clones OST472925 (lexicon) OST453303 (lexicon) OST435728 (lexicon) OST434430 (lexicon)
OST385204 (lexicon) OST383147 (lexicon) OST371032 (lexicon) OST369089 (lexicon)
OST341216 (lexicon) OST308487 (lexicon) OST305402 (lexicon) OST305356 (lexicon)
OST301995 (lexicon) OST292918 (lexicon) OST287214 (lexicon) OST269223 (lexicon)
OST266059 (lexicon) OST264832 (lexicon) OST262233 (lexicon) OST249284 (lexicon)
OST232387 (lexicon) OST232348 (lexicon) OST221973 (lexicon) OST211407 (lexicon)
OST208510 (lexicon) OST190087 (lexicon) OST164942 (lexicon) OST145475 (lexicon)
OST132247 (lexicon) OST109816 (lexicon) OST109760 (lexicon) OST86332 (lexicon)
OST82871 (lexicon) OST35758 (lexicon) OST32846 (lexicon) OST32593 (lexicon)
OST32589 (lexicon) OST32586 (lexicon) OST32575 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000630305 (Chr4:147525723..147526001 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000630305 (Chr4:147525723..147526001 -)
Downstram Exon
ENSMUSE00000717444 (Chr4:147523488..147523775 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GACTCTTGCGCTTCCATAGG Chr4:147523577..147523596 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447489 Chr4:147526051..147526168 GCTCCGAGCTCACCATCTTC Chr4:147526078..147526097 62.41 60
upstream ENSMUSE00000630305 Chr4:147525723..147526001 No primer for this exon
upstream ENSMUSE00000667225 Chr4:147525197..147526017 CCGTGTAGGCAGCTTTTAGG Chr4:147525522..147525541 59.9 55

*** Putative Vector Insertion (Chr 4: 147523776 - 147525722) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184381 Chr4:147523488..147523775 GACTCTTGCGCTTCCATAGG Chr4:147523577..147523596 59.98 55
downstream ENSMUSE00000717444 Chr4:147523488..147523775 GACTCTTGCGCTTCCATAGG Chr4:147523577..147523596 59.98 55
downstream ENSMUSE00000184372 Chr4:147521404..147521530 ATCCCCTCCGTTGGAGTCTA Chr4:147521468..147521487 60.84 55
downstream ENSMUSE00000184375 Chr4:147520949..147521044 No primer for this exon
downstream ENSMUSE00000184362 Chr4:147520430..147520565 CAGCTGTACCCGGAGTTGAT Chr4:147520492..147520511 60.13 55
downstream ENSMUSE00000447503 Chr4:147519897..147520294 GAGCCTGACTGCCCACTAAC Chr4:147519988..147520007 59.87 60
downstream ENSMUSE00000630300 Chr4:147519825..147520294 GAGCCTGACTGCCCACTAAC Chr4:147519988..147520007 59.87 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCCTGGTGTGGATTTTA Chr4:147525675..147525695 61.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCCTGGTGTGGATTTTA Chr4:147525675..147525695 61.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTAATCGCCTTGCAGCACAT Chr4:147525932..147525953 62.86 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTTCGTGACTGGGAAAACC Chr4:147525935..147525955 61.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055401