Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15804
Trapped Gene
Ahcyl2 (ENSMUSG00000029772)
Vector Insertion
Chr 6: 29718907 - 29749438
Public Clones (sanger) (sanger) (ggtc) (ggtc) IST13127D8 (tigm) IST12016H1 (tigm)
IST12016H1 (tigm) IST14494E12 (tigm) IST10990C5 (tigm)
Private Clones OST472754 (lexicon) OST429991 (lexicon) OST390621 (lexicon) OST376965 (lexicon)
OST224745 (lexicon) OST145181 (lexicon) OST89364 (lexicon) OST86453 (lexicon)
OST61640 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660968 (Chr6:29718492..29718906 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGTGCGAGAGTCAGAGT Chr6:29718495..29718514 60.77 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660968 (Chr6:29718492..29718906 +)
Downstram Exon
ENSMUSE00000656008 (Chr6:29749439..29749552 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGTGCGAGAGTCAGAGT Chr6:29718495..29718514 60.77 60 TCCTCGGGTACAGCTACTGG Chr6:29749479..29749498 60.27 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656007 Chr6:29718480..29718906 GCTGGTGCGAGAGTCAGAGT Chr6:29718495..29718514 60.77 60
upstream ENSMUSE00000660968 Chr6:29718492..29718906 GCTGGTGCGAGAGTCAGAGT Chr6:29718495..29718514 60.77 60
upstream ENSMUSE00000370905 Chr6:29718533..29718906 AGGTGGAGCTGAAGGATCTG Chr6:29718584..29718603 59.4 55

*** Putative Vector Insertion (Chr 6: 29718907 - 29749438) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000656008 Chr6:29749439..29749552 TCCTCGGGTACAGCTACTGG Chr6:29749479..29749498 60.27 60
downstream ENSMUSE00000702136 Chr6:29803825..29804139 CCTGGCGAATCTCTTACCAG Chr6:29803904..29803923 59.83 55
downstream ENSMUSE00000702132 Chr6:29809723..29809779 No primer for this exon
downstream ENSMUSE00000564207 Chr6:29813140..29813251 GATTTTGGTGGGACGTTTGT Chr6:29813196..29813215 59.69 45
downstream ENSMUSE00000702143 Chr6:29813143..29813251 GATTTTGGTGGGACGTTTGT Chr6:29813196..29813215 59.69 45
downstream ENSMUSE00000564205 Chr6:29820568..29820711 CCAAACTCCGCTTGTTTGAT Chr6:29820685..29820704 60.11 45
downstream ENSMUSE00000192531 Chr6:29821186..29821286 GCTTTTCTCCTTGGGCTCTC Chr6:29821236..29821255 60.46 55
downstream ENSMUSE00000301439 Chr6:29828529..29828631 CCACTTCATTGAGGGTGGAG Chr6:29828613..29828632 60.5 55
downstream ENSMUSE00000192539 Chr6:29830549..29830643 ATCTGTCAATGCACCACCAA Chr6:29830614..29830633 59.97 45
downstream ENSMUSE00000192542 Chr6:29833623..29833729 TCTCCTCGACTATGCCTTTGA Chr6:29833712..29833732 59.96 47.62
downstream ENSMUSE00000564201 Chr6:29836118..29836234 CTTCCCAGCTTTGGACAGTT Chr6:29836148..29836167 59.33 50
downstream ENSMUSE00000192522 Chr6:29840681..29840744 CCTGCTTTCCACCAAACATC Chr6:29840724..29840743 60.49 50
downstream ENSMUSE00000564197 Chr6:29841201..29841289 GCACAGATGGGGTCAATCTC Chr6:29841280..29841299 60.48 55
downstream ENSMUSE00000192518 Chr6:29844819..29844889 GTCGACCTGTCGGATGACTT Chr6:29844873..29844892 60.12 55
downstream ENSMUSE00000564195 Chr6:29846322..29846416 CACATCAATCTCGGTGTTGG Chr6:29846419..29846438 59.96 50
downstream ENSMUSE00000192521 Chr6:29853189..29853287 CCAGGTCAGTTCTGGTGTCC Chr6:29853221..29853240 60.56 60
downstream ENSMUSE00000564192 Chr6:29856508..29856576 GCAGTGATGGAGAGCACAAA Chr6:29856569..29856588 59.99 50
downstream ENSMUSE00000192541 Chr6:29856681..29856759 GCTTATAGCGACCCTCAGGA Chr6:29856732..29856751 59.43 55
downstream ENSMUSE00000660967 Chr6:29858347..29858467 ATCAAAGGTGGGCAGGTGTA Chr6:29858387..29858406 60.38 50
downstream ENSMUSE00000660966 Chr6:29859040..29862304 GCCCCACGAGTTAGTAACCA Chr6:29859254..29859273 59.99 55
downstream ENSMUSE00000702134 Chr6:29859040..29859213 GCAGCTTGCTAGGTTCTTCC Chr6:29859137..29859156 59.22 55
downstream ENSMUSE00000702147 Chr6:29859040..29862309 GCCCCACGAGTTAGTAACCA Chr6:29859254..29859273 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAAGCTAATCGCCTTGCAG Chr6:29736951..29736972 60.01 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAAAACAGAAGGGTCGTG Chr6:29736942..29736962 60.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029772