Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15820
Trapped Gene
2310016M24Rik (ENSMUSG00000023020)
Vector Insertion
Chr 15: 99556280 - 99558075
Public Clones not available
Private Clones OST472496 (lexicon) OST448224 (lexicon) OST441486 (lexicon) OST419185 (lexicon)
OST309977 (lexicon) OST77958 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132744 (Chr15:99556078..99556279 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCTGGCTCTCGCTTTAGT Chr15:99556094..99556113 60.67 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132744 (Chr15:99556078..99556279 +)
Downstram Exon
ENSMUSE00000132743 (Chr15:99558076..99558545 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCTGGCTCTCGCTTTAGT Chr15:99556094..99556113 60.67 55 GATATCGGCTAGCTGCTTGG Chr15:99558116..99558135 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000132744 Chr15:99556078..99556279 AGGCTGGCTCTCGCTTTAGT Chr15:99556094..99556113 60.67 55

*** Putative Vector Insertion (Chr 15: 99556280 - 99558075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132743 Chr15:99558076..99558545 GATATCGGCTAGCTGCTTGG Chr15:99558116..99558135 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTTGCAGCCTCCAGGTAG Chr15:99556265..99556285 60.01 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTTGCAGCCTCCAGGTAG Chr15:99556265..99556285 60.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023020