Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15823
Trapped Gene
Tmem208 (ENSMUSG00000014856)
Vector Insertion
Chr 8: 107851047 - 107852069
Public Clones not available
Private Clones OST472416 (lexicon) OST413565 (lexicon) OST40346 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214307 (Chr8:107850951..107851046 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214307 (Chr8:107850951..107851046 +)
Downstram Exon
ENSMUSE00000214304 (Chr8:107852070..107852129 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000233810 Chr8:107850277..107850374 No primer for this exon
upstream ENSMUSE00000680032 Chr8:107850362..107850374 No primer for this exon
upstream ENSMUSE00000214307 Chr8:107850951..107851046 No primer for this exon

*** Putative Vector Insertion (Chr 8: 107851047 - 107852069) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214304 Chr8:107852070..107852129 No primer for this exon
downstream ENSMUSE00000214306 Chr8:107852222..107852358 No primer for this exon
downstream ENSMUSE00000214305 Chr8:107852508..107852592 No primer for this exon
downstream ENSMUSE00000402225 Chr8:107852672..107852951 No primer for this exon
downstream ENSMUSE00000680031 Chr8:107852672..107852802 No primer for this exon
downstream ENSMUSE00000634764 Chr8:107858543..107858774 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTGCTTGCCTTGTGCTTT Chr8:107851051..107851071 60.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTGCTTGCCTTGTGCTTT Chr8:107851051..107851071 60.06 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014856