Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15833
Trapped Gene
Ube2n (ENSMUSG00000074781)
Vector Insertion
Chr 10: 95003816 - 95003838
Public Clones CMHD-GT_381H5-3 (cmhd)
Private Clones OST472146 (lexicon) OST432016 (lexicon) OST421206 (lexicon) OST379841 (lexicon)
OST374154 (lexicon) OST367567 (lexicon) OST351924 (lexicon) OST341569 (lexicon)
OST322961 (lexicon) OST308893 (lexicon) OST278308 (lexicon) OST222384 (lexicon)
OST208316 (lexicon) OST206872 (lexicon) OST206072 (lexicon) OST187165 (lexicon)
OST166529 (lexicon) OST133252 (lexicon) OST105438 (lexicon) OST50051 (lexicon)
OST22251 (lexicon) OST18592 (lexicon) OST17635 (lexicon) OST12535 (lexicon)
OST7187 (lexicon) OST711 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640786 (Chr10:95003783..95003815 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640786 (Chr10:95003783..95003815 +)
Downstram Exon
ENSMUSE00000640785 (Chr10:95003839..95004085 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TAGGTGCTGCCATTGGGTAT Chr10:95004013..95004032 60.35 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640786 Chr10:95003783..95003815 No primer for this exon

*** Putative Vector Insertion (Chr 10: 95003816 - 95003838) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640785 Chr10:95003839..95004085 TAGGTGCTGCCATTGGGTAT Chr10:95004013..95004032 60.35 50
downstream ENSMUSE00000640784 Chr10:95004272..95004412 TTGCTCGGCTACATCATTTG Chr10:95004381..95004400 59.83 45
downstream ENSMUSE00000640783 Chr10:95004906..95008292 GCAGGAGGACTCAAAACTGC Chr10:95006138..95006157 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTAATCGCCTTGCAGCACA Chr10:95003838..95003858 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTAGCGTGACTGGGAAAAC Chr10:95003834..95003855 60.16 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074781