Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15835
Trapped Gene
Atad1 (ENSMUSG00000013662)
Vector Insertion
Chr 19: 32781500 - 32786755
Public Clones CMHD-GT_403F11-3 (cmhd) IST14221G8 (tigm) IST15057H7 (tigm) IST14140G7 (tigm)
Private Clones OST472110 (lexicon) OST430980 (lexicon) OST187062 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388512 (Chr19:32786756..32786812 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388512 (Chr19:32786756..32786812 -)
Downstram Exon
ENSMUSE00000272067 (Chr19:32781325..32781499 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388512 Chr19:32786756..32786812 No primer for this exon

*** Putative Vector Insertion (Chr 19: 32781500 - 32786755) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000272067 Chr19:32781325..32781499 No primer for this exon
downstream ENSMUSE00000449883 Chr19:32777030..32777128 No primer for this exon
downstream ENSMUSE00000145936 Chr19:32776010..32776130 No primer for this exon
downstream ENSMUSE00000145927 Chr19:32772930..32773130 No primer for this exon
downstream ENSMUSE00000145926 Chr19:32770282..32770388 No primer for this exon
downstream ENSMUSE00000145934 Chr19:32761723..32761812 No primer for this exon
downstream ENSMUSE00000145945 Chr19:32758492..32758542 No primer for this exon
downstream ENSMUSE00000145943 Chr19:32751207..32751340 No primer for this exon
downstream ENSMUSE00000449864 Chr19:32747050..32748854 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGCCTCTGGGTGAGTAG Chr19:32783746..32783766 60.4 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCATCGTCTCTGGTCCT Chr19:32783762..32783782 61.61 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr19:32783743..32783763 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTGACCCTGGAGCTAATTCCT Chr19:32783818..32783839 60.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013662