Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15869
Trapped Gene
Mettl5 (ENSMUSG00000051730)
Vector Insertion
Chr 2: 69709374 - 69709788
Public Clones not available
Private Clones OST471245 (lexicon) OST413662 (lexicon) OST412326 (lexicon) OST396960 (lexicon)
OST391133 (lexicon) OST345065 (lexicon) OST318955 (lexicon) OST154761 (lexicon)
OST133285 (lexicon) OST18709 (lexicon) OST8645 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690972 (Chr2:69709789..69709838 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690972 (Chr2:69709789..69709838 -)
Downstram Exon
ENSMUSE00000690971 (Chr2:69709271..69709373 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644731 Chr2:69723306..69723654 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55
upstream ENSMUSE00000690970 Chr2:69723306..69723661 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55
upstream ENSMUSE00000372008 Chr2:69719354..69719468 ATTGAAAACAAAGCGGTTGC Chr2:69719411..69719430 60.12 40
upstream ENSMUSE00000414234 Chr2:69718824..69719005 CTCCCTTTGGGACCAAAAAT Chr2:69718831..69718850 60.16 45
upstream ENSMUSE00000333101 Chr2:69717159..69717241 GAAGACTGCTTTGGGAATGG Chr2:69717203..69717222 59.67 50
upstream ENSMUSE00000690969 Chr2:69715805..69717241 AACTCAGACCCACCATCAGG Chr2:69716843..69716862 59.96 55
upstream ENSMUSE00000690974 Chr2:69711941..69711992 GCTGCTGAATGGAAAGTCAA Chr2:69711958..69711977 59 45
upstream ENSMUSE00000690972 Chr2:69709789..69709838 No primer for this exon

*** Putative Vector Insertion (Chr 2: 69709374 - 69709788) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690971 Chr2:69709271..69709373 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:69709717..69709737 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTTGCGTGACTGGGAAAAC Chr2:69709722..69709743 61.91 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051730