Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15871
Trapped Gene
Gramd2 (ENSMUSG00000074259)
Vector Insertion
Chr 9: 59555567 - 59555806
Public Clones not available
Private Clones OST471239 (lexicon) OST351202 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636342 (Chr9:59555523..59555566 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636342 (Chr9:59555523..59555566 +)
Downstram Exon
ENSMUSE00000636341 (Chr9:59555807..59555902 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGACCTTTCCTGGTTTCTCC Chr9:59555883..59555902 59.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636342 Chr9:59555523..59555566 No primer for this exon

*** Putative Vector Insertion (Chr 9: 59555567 - 59555806) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000697967 Chr9:59555571..59555902 TTCAAATGCTGTGCCCATTA Chr9:59555668..59555687 60.07 40
downstream ENSMUSE00000636341 Chr9:59555807..59555902 GGACCTTTCCTGGTTTCTCC Chr9:59555883..59555902 59.91 55
downstream ENSMUSE00000636340 Chr9:59557259..59557316 CCCTTCCCGGCTATACTTCT Chr9:59557319..59557338 59.57 55
downstream ENSMUSE00000636339 Chr9:59557669..59557744 No primer for this exon
downstream ENSMUSE00000636338 Chr9:59558309..59558412 ATAGAGCCGACCATGGAGAA Chr9:59558361..59558380 59.65 50
downstream ENSMUSE00000636336 Chr9:59558973..59559071 AAGGAGTCGTGCCATCTTGT Chr9:59559035..59559054 59.73 50
downstream ENSMUSE00000636335 Chr9:59559352..59559423 GACCCTCCTCAGCATGTCATA Chr9:59559410..59559430 60.09 52.38
downstream ENSMUSE00000636334 Chr9:59559891..59559953 No primer for this exon
downstream ENSMUSE00000636333 Chr9:59561603..59561747 GGAGTCTGTCGGGATCTGAG Chr9:59561710..59561729 59.79 60
downstream ENSMUSE00000636332 Chr9:59561984..59562080 GAATCCCACAGCCTCAGTTC Chr9:59562056..59562075 59.66 55
downstream ENSMUSE00000636331 Chr9:59563730..59563834 TTCGGAATGCCAGATAGGAC Chr9:59563776..59563795 60.04 50
downstream ENSMUSE00000697968 Chr9:59564015..59564231 CAGCACAGCCGCAGTATAAA Chr9:59564114..59564133 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:59555618..59555638 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000074259