Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15873
Trapped Gene
Nradd (ENSMUSG00000032491)
Vector Insertion
Chr 9: 110525740 - 110526818
Public Clones (cmhd) CMHD-GT_418G2-3 (cmhd) IST14629F7 (tigm) IST14729B5 (tigm)
IST14562A1 (tigm) IST15001A3 (tigm)
Private Clones OST471205 (lexicon) OST432114 (lexicon) OST337025 (lexicon) OST325598 (lexicon)
OST232622 (lexicon) OST53696 (lexicon) OST49016 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000404326 (Chr9:110526819..110526882 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTCCCGTCGTCTTCCTAGC Chr9:110526859..110526878 60.79 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000404326 (Chr9:110526819..110526882 -)
Downstram Exon
ENSMUSE00000346673 (Chr9:110525591..110525739 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTCCCGTCGTCTTCCTAGC Chr9:110526859..110526878 60.79 60 TTGGTGAAGGGGAGTTGTGT Chr9:110525639..110525658 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404326 Chr9:110526819..110526882 ACTCCCGTCGTCTTCCTAGC Chr9:110526859..110526878 60.79 60

*** Putative Vector Insertion (Chr 9: 110525740 - 110526818) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346673 Chr9:110525591..110525739 TTGGTGAAGGGGAGTTGTGT Chr9:110525639..110525658 60.4 50
downstream ENSMUSE00000446483 Chr9:110524576..110524765 ACATAGGCCAGCAGACCAAG Chr9:110524566..110524585 60.28 55
downstream ENSMUSE00000220085 Chr9:110524344..110524486 GAGGAGAGTCCACGAAGACG Chr9:110524352..110524371 59.99 60
downstream ENSMUSE00000496245 Chr9:110523642..110524241 ATAGGCTGGCATTTGGTCAC Chr9:110524041..110524060 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGAATAATCGCCTTGCAG Chr9:110526753..110526773 60.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCCTTGGCTCACTCTTG Chr9:110526905..110526925 61.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 CTTGCCTTGGCTCACTCTTG Chr9:110526905..110526925 61.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032491