Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15876
Trapped Gene
BC049807 (ENSMUSG00000067931)
Vector Insertion
Chr 17: 21706092 - 21710820
Public Clones not available
Private Clones OST471187 (lexicon) OST49055 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000554388 (Chr17:21706013..21706091 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGATCACCCAGACCTGCTT Chr17:21706019..21706038 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000554388 (Chr17:21706013..21706091 +)
Downstram Exon
ENSMUSE00000554387 (Chr17:21710821..21710920 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGATCACCCAGACCTGCTT Chr17:21706019..21706038 60.26 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000554389 Chr17:21703972..21704209 TGGGACGAAGAACCAGAAGT Chr17:21703986..21704005 59.7 50
upstream ENSMUSE00000554388 Chr17:21706013..21706091 CTGATCACCCAGACCTGCTT Chr17:21706019..21706038 60.26 55

*** Putative Vector Insertion (Chr 17: 21706092 - 21710820) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000554387 Chr17:21710821..21710920 No primer for this exon
downstream ENSMUSE00000554386 Chr17:21719997..21720109 No primer for this exon
downstream ENSMUSE00000554385 Chr17:21721747..21721873 CCACAAACACCAGGTTGCTA Chr17:21721876..21721895 59.61 50
downstream ENSMUSE00000554382 Chr17:21723672..21725663 GTTGCTCCCGTTGTAAAGGA Chr17:21725121..21725140 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAATGTGGTAATCGCCTTG Chr17:21709134..21709154 59.54 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGGAGAGGGAGAACACAG Chr17:21709058..21709078 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067931