Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15887
Trapped Gene
9130230L23Rik (ENSMUSG00000054598)
Vector Insertion
Chr 5: 66381664 - 66391443
Public Clones IST14970H4 (tigm) IST12733E8 (tigm)
Private Clones OST470938 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696828 (Chr5:66391444..66391694 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAGGCGAAGTTGAGCAAG Chr5:66391490..66391509 59.76 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696828 (Chr5:66391444..66391694 -)
Downstram Exon
ENSMUSE00000452503 (Chr5:66381525..66381663 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAGGCGAAGTTGAGCAAG Chr5:66391490..66391509 59.76 50 CCATCAGCTCTGGGATCAAT Chr5:66381585..66381604 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696831 Chr5:66395449..66395524 GTGGCGAAAACTGCCTAGAG Chr5:66395467..66395486 60.01 55
upstream ENSMUSE00000696830 Chr5:66392471..66392678 GAGTGCACTGTGCCTACGAA Chr5:66392558..66392577 60.06 55
upstream ENSMUSE00000696829 Chr5:66392123..66392216 TGGATCCGGGTTCCTACTAA Chr5:66392130..66392149 59.38 50
upstream ENSMUSE00000696828 Chr5:66391444..66391694 AAGAGGCGAAGTTGAGCAAG Chr5:66391490..66391509 59.76 50

*** Putative Vector Insertion (Chr 5: 66381664 - 66391443) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000452503 Chr5:66381525..66381663 CCATCAGCTCTGGGATCAAT Chr5:66381585..66381604 60.03 50
downstream ENSMUSE00000452497 Chr5:66381077..66381156 No primer for this exon
downstream ENSMUSE00000653111 Chr5:66379167..66379772 CAGGATCGAAATGGAAGGAA Chr5:66379379..66379398 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGGATAATCGCCTTGCAG Chr5:66391378..66391398 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTTCACAGTGGGGAGAAAG Chr5:66382453..66382474 60.53 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTACTGCCCAGAAGCACAGA Chr5:66391710..66391730 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTACCCGTGACTGGGAAAAC Chr5:66382629..66382649 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054598