Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15902
Trapped Gene
Dhrs7b (ENSMUSG00000042569)
Vector Insertion
Chr 11: 60657666 - 60657846
Public Clones not available
Private Clones OST470512 (lexicon) OST459800 (lexicon) OST443825 (lexicon) OST441481 (lexicon)
OST432241 (lexicon) OST428201 (lexicon) OST427659 (lexicon) OST419930 (lexicon)
OST418749 (lexicon) OST415176 (lexicon) OST412415 (lexicon) OST394801 (lexicon)
OST385838 (lexicon) OST385655 (lexicon) OST378063 (lexicon) OST375700 (lexicon)
OST335940 (lexicon) OST315510 (lexicon) OST311834 (lexicon) OST306572 (lexicon)
OST303328 (lexicon) OST303120 (lexicon) OST296196 (lexicon) OST281749 (lexicon)
OST277423 (lexicon) OST267938 (lexicon) OST266404 (lexicon) OST262889 (lexicon)
OST255410 (lexicon) OST251812 (lexicon) OST250873 (lexicon) OST243542 (lexicon)
OST240844 (lexicon) OST238014 (lexicon) OST223435 (lexicon) OST199982 (lexicon)
OST182084 (lexicon) OST176866 (lexicon) OST168820 (lexicon) OST158699 (lexicon)
OST153776 (lexicon) OST118661 (lexicon) OST111219 (lexicon) OST108478 (lexicon)
OST101014 (lexicon) OST91975 (lexicon) OST65207 (lexicon) OST43273 (lexicon)
OST41293 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242395 (Chr11:60657667..60657845 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCTCAAAGGCTTACCTGAG Chr11:60657779..60657798 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242395 (Chr11:60657667..60657845 +)
Downstram Exon
ENSMUSE00000677765 (Chr11:60657667..60657845 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCTCAAAGGCTTACCTGAG Chr11:60657779..60657798 60.15 55 GTCCATGACCCTCTCCTTCA Chr11:60657700..60657719 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677766 Chr11:60644181..60644233 GACCATGATCTCTCCGTCCT Chr11:60644210..60644229 59.06 55
upstream ENSMUSE00000242398 Chr11:60644189..60644233 GACCATGATCTCTCCGTCCT Chr11:60644210..60644229 59.06 55

*** Putative Vector Insertion (Chr 11: 60657666 - 60657846) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000242395 Chr11:60657667..60657845 GTCCATGACCCTCTCCTTCA Chr11:60657700..60657719 60.05 55
downstream ENSMUSE00000677765 Chr11:60657667..60657845 GTCCATGACCCTCTCCTTCA Chr11:60657700..60657719 60.05 55
downstream ENSMUSE00000242388 Chr11:60662603..60662706 TCACATTTCGTCCACAGAGG Chr11:60662665..60662684 59.68 50
downstream ENSMUSE00000242379 Chr11:60665244..60665460 GAGCAACAGGGCCAAAGTAG Chr11:60665454..60665473 59.88 55
downstream ENSMUSE00000242373 Chr11:60665921..60666013 GATCGGAAAGGAATGCTGAT Chr11:60666011..60666030 59.08 45
downstream ENSMUSE00000242367 Chr11:60669202..60669354 TCGGCAGTGACAGCATTTAC Chr11:60669340..60669359 59.87 50
downstream ENSMUSE00000391252 Chr11:60671220..60671647 CATGGATGGCACAAAGTCTG Chr11:60671338..60671357 60.11 50
downstream ENSMUSE00000677764 Chr11:60671220..60673697 CCAGTGCACCTCCTATGGTT Chr11:60672620..60672639 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAAGGAGAGGGTCATGGA Chr11:60657678..60657698 60.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAAGGAGAGGGTCATGGA Chr11:60657678..60657698 60.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042569