Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15905
Trapped Gene
Mtmr2 (ENSMUSG00000031918)
Vector Insertion
Chr 9: 13607983 - 13609249
Public Clones not available
Private Clones OST470465 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214642 (Chr9:13607869..13607982 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214642 (Chr9:13607869..13607982 +)
Downstram Exon
ENSMUSE00000214639 (Chr9:13609250..13609426 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTGGCTACTGGGTAAAGGA Chr9:13609366..13609385 59.34 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000312286 Chr9:13552863..13553844 CAAGCCGTCACATCTTGTGT Chr9:13553466..13553485 59.75 50
upstream ENSMUSE00000214658 Chr9:13586721..13586826 ACTCGGTGCATACCAAATCA Chr9:13586744..13586763 59 45
upstream ENSMUSE00000214652 Chr9:13590296..13590371 CCTGCTTCCAGGAGAGAACA Chr9:13590340..13590359 60.52 55
upstream ENSMUSE00000214650 Chr9:13593025..13593119 GGAACGCTGACTGTCACAAG Chr9:13593069..13593088 59.47 55
upstream ENSMUSE00000536674 Chr9:13593457..13593594 CTCCTATGGCCTGGAAACTG Chr9:13593567..13593586 59.69 55
upstream ENSMUSE00000214657 Chr9:13593484..13593594 CTCCTATGGCCTGGAAACTG Chr9:13593567..13593586 59.69 55
upstream ENSMUSE00000214643 Chr9:13596423..13596524 GGAACTTGCGATTTGCTCAT Chr9:13596430..13596449 60.22 45
upstream ENSMUSE00000214637 Chr9:13597593..13597676 CGAAAATGGGTGGAAACTGT Chr9:13597628..13597647 59.83 45
upstream ENSMUSE00000214645 Chr9:13599681..13599830 CCAGCAAACATTCCTGATGA Chr9:13599765..13599784 59.65 45
upstream ENSMUSE00000638609 Chr9:13599681..13599859 GTGGCATCCTTTAGGTCACG Chr9:13599798..13599817 60.52 55
upstream ENSMUSE00000214655 Chr9:13600402..13600590 ACTCCAATGCCCAGTCTCAC Chr9:13600520..13600539 60.12 55
upstream ENSMUSE00000474941 Chr9:13603594..13603779 TTGTGTACCCCACCATTGAA Chr9:13603706..13603725 59.67 45
upstream ENSMUSE00000703734 Chr9:13604298..13604526 CCGAACCATACGAGGATTTG Chr9:13604457..13604476 60.32 50
upstream ENSMUSE00000214656 Chr9:13604320..13604526 CCGAACCATACGAGGATTTG Chr9:13604457..13604476 60.32 50
upstream ENSMUSE00000585080 Chr9:13606359..13606451 GGCCATGGAGATAAGAACCA Chr9:13606365..13606384 59.89 50
upstream ENSMUSE00000214642 Chr9:13607869..13607982 No primer for this exon

*** Putative Vector Insertion (Chr 9: 13607983 - 13609249) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214639 Chr9:13609250..13609426 GCTGGCTACTGGGTAAAGGA Chr9:13609366..13609385 59.34 55
downstream ENSMUSE00000311975 Chr9:13609819..13610241 TGGGTTTTAAACACGGAAGG Chr9:13610066..13610085 59.83 45
downstream ENSMUSE00000558360 Chr9:13609819..13610925 TCTGACACAAGCCTCAATGC Chr9:13610362..13610381 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTGGCATGCATTTGGTTA Chr9:13608006..13608026 59.04 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTGGCATGCATTTGGTTA Chr9:13608006..13608026 59.04 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031918