Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15908
Trapped Gene
BC024479 (ENSMUSG00000042138)
Vector Insertion
Chr 9: 37297419 - 37324801
Public Clones IST11528H11 (tigm)
Private Clones OST470442 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000481222 (Chr9:37296906..37297418 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCAAAATTCCGAAGATGG Chr9:37296950..37296969 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000481222 (Chr9:37296906..37297418 +)
Downstram Exon
ENSMUSE00000352073 (Chr9:37324802..37325057 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCAAAATTCCGAAGATGG Chr9:37296950..37296969 59.65 45 CCATGTTCTTTCACCCGACT Chr9:37324842..37324861 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000481222 Chr9:37296906..37297418 GCTCAAAATTCCGAAGATGG Chr9:37296950..37296969 59.65 45

*** Putative Vector Insertion (Chr 9: 37297419 - 37324801) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352073 Chr9:37324802..37325057 CCATGTTCTTTCACCCGACT Chr9:37324842..37324861 59.97 50
downstream ENSMUSE00000330817 Chr9:37326312..37326372 No primer for this exon
downstream ENSMUSE00000392141 Chr9:37330275..37331733 CAGCGGGTGTTATAGCCAAT Chr9:37330421..37330440 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAACACCAGTTCTGCTTTGGA Chr9:37300404..37300425 59.77 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACACGTGACTGGGAAAAC Chr9:37300465..37300485 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042138