Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15926
Trapped Gene
Chchd5 (ENSMUSG00000037938)
Vector Insertion
Chr 2: 128955594 - 128955913
Public Clones D079B06 (ggtc) D079B06 (ggtc)
Private Clones OST470178 (lexicon) OST467013 (lexicon) OST260592 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000263102 (Chr2:128955545..128955593 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGGTCTCTTCTCCCTGACT Chr2:128955547..128955566 60.78 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000263102 (Chr2:128955545..128955593 +)
Downstram Exon
ENSMUSE00000358210 (Chr2:128955914..128956054 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGGTCTCTTCTCCCTGACT Chr2:128955547..128955566 60.78 60 AATCTCGATGCCACGACTCT Chr2:128956014..128956033 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000263102 Chr2:128955545..128955593 CGGGTCTCTTCTCCCTGACT Chr2:128955547..128955566 60.78 60

*** Putative Vector Insertion (Chr 2: 128955594 - 128955913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358210 Chr2:128955914..128956054 AATCTCGATGCCACGACTCT Chr2:128956014..128956033 59.83 50
downstream ENSMUSE00000396198 Chr2:128956137..128956302 TCCAGTTGTGGGTGAACTTG Chr2:128956302..128956321 59.56 50
downstream ENSMUSE00000366170 Chr2:128959011..128959190 ATCAAGTGGGACGGTCAATC Chr2:128959087..128959106 59.79 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGTCAGACTGCACGGTA Chr2:128955627..128955647 60.06 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAATTCGCCTGGAGATGT Chr2:128955577..128955597 60.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037938