Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15945
Trapped Gene
Vapb (ENSMUSG00000054455)
Vector Insertion
Chr 2: 173601790 - 173603563
Public Clones PST19547-NR (escells)
Private Clones OST469582 (lexicon) OST451881 (lexicon) OST379718 (lexicon) OST357667 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000170242 (Chr2:173601613..173601789 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGTGCATCCAAGACAGAA Chr2:173601644..173601663 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000170242 (Chr2:173601613..173601789 +)
Downstram Exon
ENSMUSE00000446334 (Chr2:173603564..173604849 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGTGCATCCAAGACAGAA Chr2:173601644..173601663 59.98 50 GTCCTACGGCAACAGACCAT Chr2:173603968..173603987 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349103 Chr2:173563083..173563251 AAGGTGGAACAGGTCCTGAG Chr2:173563200..173563219 59.15 55
upstream ENSMUSE00000548835 Chr2:173587618..173587770 CCAACAGACCGAAATGTGTG Chr2:173587662..173587681 60 50
upstream ENSMUSE00000170240 Chr2:173597022..173597125 CTCCGCCTGACACTTCTGAT Chr2:173597094..173597113 60.41 55
upstream ENSMUSE00000170243 Chr2:173599895..173599975 GTGTTTGAATTGCCAGCAGA Chr2:173599943..173599962 59.85 45
upstream ENSMUSE00000170242 Chr2:173601613..173601789 CGAGTGCATCCAAGACAGAA Chr2:173601644..173601663 59.98 50

*** Putative Vector Insertion (Chr 2: 173601790 - 173603563) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000446334 Chr2:173603564..173604849 GTCCTACGGCAACAGACCAT Chr2:173603968..173603987 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGCAGGCAGCTCAAGGTA Chr2:173601774..173601794 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCAGGCAGCTCAAGGTA Chr2:173601774..173601794 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054455