Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15950
Trapped Gene
Cobl (ENSMUSG00000020173)
Vector Insertion
Chr 11: 12286565 - 12286770
Public Clones CMHD-GT_523F7-3 (cmhd)
Private Clones OST469503 (lexicon) OST348667 (lexicon) OST252080 (lexicon) OST215183 (lexicon)
OST198118 (lexicon) OST196985 (lexicon) OST180969 (lexicon) OST172841 (lexicon)
OST148543 (lexicon) OST131525 (lexicon) OST91951 (lexicon) OST68205 (lexicon)
OST51909 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000332930 (Chr11:12286566..12286769 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000332930 (Chr11:12286566..12286769 -)
Downstram Exon
ENSMUSE00000581044 (Chr11:12286566..12286769 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681104 Chr11:12364685..12364755 No primer for this exon
upstream ENSMUSE00000681112 Chr11:12364685..12364862 No primer for this exon
upstream ENSMUSE00000712382 Chr11:12364685..12364803 No primer for this exon
upstream ENSMUSE00000715574 Chr11:12364685..12364803 No primer for this exon
upstream ENSMUSE00000332930 Chr11:12286566..12286769 No primer for this exon
upstream ENSMUSE00000581044 Chr11:12286566..12286769 No primer for this exon

*** Putative Vector Insertion (Chr 11: 12286565 - 12286770) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581043 Chr11:12278152..12278362 No primer for this exon
downstream ENSMUSE00000711386 Chr11:12278152..12278362 No primer for this exon
downstream ENSMUSE00000712800 Chr11:12278152..12278362 No primer for this exon
downstream ENSMUSE00000581035 Chr11:12275813..12276041 No primer for this exon
downstream ENSMUSE00000655456 Chr11:12275813..12276041 No primer for this exon
downstream ENSMUSE00000581031 Chr11:12273332..12273376 No primer for this exon
downstream ENSMUSE00000581034 Chr11:12269597..12269694 No primer for this exon
downstream ENSMUSE00000655454 Chr11:12269597..12269694 No primer for this exon
downstream ENSMUSE00000655452 Chr11:12265108..12265182 No primer for this exon
downstream ENSMUSE00000710141 Chr11:12243747..12243920 No primer for this exon
downstream ENSMUSE00000717520 Chr11:12243747..12243920 No primer for this exon
downstream ENSMUSE00000681102 Chr11:12243005..12243014 No primer for this exon
downstream ENSMUSE00000681101 Chr11:12242618..12242625 No primer for this exon
downstream ENSMUSE00000655448 Chr11:12209617..12209755 No primer for this exon
downstream ENSMUSE00000681099 Chr11:12209617..12209755 No primer for this exon
downstream ENSMUSE00000329082 Chr11:12206961..12207131 No primer for this exon
downstream ENSMUSE00000681098 Chr11:12206961..12207131 No primer for this exon
downstream ENSMUSE00000581033 Chr11:12196527..12196570 No primer for this exon
downstream ENSMUSE00000443865 Chr11:12166859..12167147 No primer for this exon
downstream ENSMUSE00000681097 Chr11:12166859..12167147 No primer for this exon
downstream ENSMUSE00000349789 Chr11:12156148..12156245 No primer for this exon
downstream ENSMUSE00000681096 Chr11:12156148..12156245 No primer for this exon
downstream ENSMUSE00000390287 Chr11:12153092..12154974 No primer for this exon
downstream ENSMUSE00000681094 Chr11:12153090..12154974 No primer for this exon
downstream ENSMUSE00000329219 Chr11:12151026..12151145 No primer for this exon
downstream ENSMUSE00000681093 Chr11:12151026..12151143 No primer for this exon
downstream ENSMUSE00000329214 Chr11:12149653..12149916 No primer for this exon
downstream ENSMUSE00000681092 Chr11:12149653..12149916 No primer for this exon
downstream ENSMUSE00000681105 Chr11:12148809..12148823 No primer for this exon
downstream ENSMUSE00000594209 Chr11:12136681..12138062 No primer for this exon
downstream ENSMUSE00000681108 Chr11:12136679..12138062 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAAGCGTAAAACCCTCAT Chr11:12286797..12286817 61.36 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAAGCGTAAAACCCTCAT Chr11:12286797..12286817 61.36 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020173