Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15963
Trapped Gene
Eif1ay (ENSMUSG00000067194)
Vector Insertion
Chr X: 155810348 - 155814312
Public Clones not available
Private Clones OST469260 (lexicon) OST421523 (lexicon) OST88256 (lexicon) OST81039 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691842 (ChrX:155810179..155810347 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691842 (ChrX:155810179..155810347 +)
Downstram Exon
ENSMUSE00000543737 (ChrX:155814313..155814396 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691842 ChrX:155810179..155810347 No primer for this exon

*** Putative Vector Insertion (Chr X: 155810348 - 155814312) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000543737 ChrX:155814313..155814396 No primer for this exon
downstream ENSMUSE00000543733 ChrX:155815391..155815494 CTAATCGTCCGTTTCCCAAC ChrX:155815435..155815454 59.43 50
downstream ENSMUSE00000543729 ChrX:155816471..155816521 GTAATCTCGTAGCCCCACCA ChrX:155816521..155816540 59.96 55
downstream ENSMUSE00000543722 ChrX:155817662..155817743 No primer for this exon
downstream ENSMUSE00000543712 ChrX:155820620..155820711 CATCATCCCCAATGTCATCA ChrX:155820697..155820716 60.14 45
downstream ENSMUSE00000691806 ChrX:155823340..155823631 TGGAAGGGGTCAAAGTAGGA ChrX:155823588..155823607 59.52 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCATTTTCCTCTCACCTGTCAT ChrX:155810328..155810351 59.99 39.13 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATTTTCCTCTCACCTGTCAT ChrX:155810328..155810351 59.99 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067194