Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15966
Trapped Gene
2810021B07Rik (ENSMUSG00000012429)
Vector Insertion
Chr 13: 17787655 - 17788675
Public Clones (sanger) (ggtc) D106E11 (ggtc) IST14427E5 (tigm)
Private Clones OST469199 (lexicon) OST396479 (lexicon) OST314677 (lexicon) OST306708 (lexicon)
OST265128 (lexicon) OST253082 (lexicon) OST140370 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336687 (Chr13:17787479..17787654 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336687 (Chr13:17787479..17787654 +)
Downstram Exon
ENSMUSE00000618086 (Chr13:17788676..17788793 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000338403 Chr13:17787247..17787654 No primer for this exon
upstream ENSMUSE00000363669 Chr13:17787319..17787477 No primer for this exon
upstream ENSMUSE00000336687 Chr13:17787479..17787654 No primer for this exon

*** Putative Vector Insertion (Chr 13: 17787655 - 17788675) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000504975 Chr13:17788676..17790939 No primer for this exon
downstream ENSMUSE00000618086 Chr13:17788676..17788793 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCATCAGTTCGGCTACTCC Chr13:17787609..17787629 59.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCATCAGTTCGGCTACTCC Chr13:17787609..17787629 59.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000012429