Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15972
Trapped Gene
Grtp1 (ENSMUSG00000038515)
Vector Insertion
Chr 8: 13177143 - 13179322
Public Clones not available
Private Clones OST469143 (lexicon) OST232071 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273420 (Chr8:13179323..13179508 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGATCTGGGACTGTCTGTT Chr8:13179480..13179499 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273420 (Chr8:13179323..13179508 -)
Downstram Exon
ENSMUSE00000685645 (Chr8:13175162..13177142 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGATCTGGGACTGTCTGTT Chr8:13179480..13179499 60.11 55 ATGGGACAATGTCGGGATAA Chr8:13175367..13175386 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514028 Chr8:13200481..13200620 GCTGCAGAGGTTGTGAGTCC Chr8:13200551..13200570 61.02 60
upstream ENSMUSE00000273480 Chr8:13200049..13200200 ATCGATCCGTATGGGTTTGA Chr8:13200180..13200199 60.15 45
upstream ENSMUSE00000273469 Chr8:13192050..13192208 GCTATGTCCGGAAGGGAATC Chr8:13192183..13192202 60.8 55
upstream ENSMUSE00000273458 Chr8:13189623..13189747 CCTGACAACGTGATGTTTCG Chr8:13189711..13189730 60.15 50
upstream ENSMUSE00000273446 Chr8:13188510..13188560 GCAGGATTGCGAAGTTCTCT Chr8:13188514..13188533 59.58 50
upstream ENSMUSE00000273440 Chr8:13186883..13186979 GACGCTCTTGTTGGAAGGAT Chr8:13186891..13186910 59.29 50
upstream ENSMUSE00000273430 Chr8:13179583..13179755 TCTGCCTGTTTGTGGACATC Chr8:13179595..13179614 59.68 50
upstream ENSMUSE00000273420 Chr8:13179323..13179508 CGGATCTGGGACTGTCTGTT Chr8:13179480..13179499 60.11 55

*** Putative Vector Insertion (Chr 8: 13177143 - 13179322) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000685645 Chr8:13175162..13177142 ATGGGACAATGTCGGGATAA Chr8:13175367..13175386 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGGCTATTTGGCCTGATT Chr8:13179294..13179314 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGGCTATTTGGCCTGATT Chr8:13179294..13179314 61.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038515