Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15981
Trapped Gene
Glis2 (ENSMUSG00000014303)
Vector Insertion
Chr 16: 4594936 - 4608597
Public Clones (sanger) (sanger) E022F09 (ggtc) (ggtc) D073G05 (ggtc) D090F10 (ggtc)
(ggtc) E022F09 (ggtc) D073G05 (ggtc) (ggtc) IST14330G9 (tigm) IST14389E5 (tigm)
IST14141F4 (tigm) IST14423A1 (tigm) IST12280E8 (tigm) IST14557C2 (tigm)
IST11552D7 (tigm) IST14791H12 (tigm) IST14174G2 (tigm) IST10454H4 (tigm)
IST12280E8 (tigm) IST12280F8 (tigm)
Private Clones OST468724 (lexicon) OST440622 (lexicon) OST438185 (lexicon) OST423144 (lexicon)
OST417008 (lexicon) OST402037 (lexicon) OST401060 (lexicon) OST393199 (lexicon)
OST368114 (lexicon) OST362149 (lexicon) OST357814 (lexicon) OST355235 (lexicon)
OST350517 (lexicon) OST332571 (lexicon) OST308694 (lexicon) OST302443 (lexicon)
OST275695 (lexicon) OST259834 (lexicon) OST240350 (lexicon) OST237121 (lexicon)
OST233310 (lexicon) OST213880 (lexicon) OST209233 (lexicon) OST200497 (lexicon)
OST199101 (lexicon) OST151226 (lexicon) OST109686 (lexicon) OST45376 (lexicon)
OST45375 (lexicon) OST41565 (lexicon) OST37412 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000512864 (Chr16:4594713..4594935 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000512864 (Chr16:4594713..4594935 +)
Downstram Exon
ENSMUSE00000345578 (Chr16:4608598..4608818 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512864 Chr16:4594713..4594935 No primer for this exon

*** Putative Vector Insertion (Chr 16: 4594936 - 4608597) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345578 Chr16:4608598..4608818 No primer for this exon
downstream ENSMUSE00000127807 Chr16:4610258..4610430 No primer for this exon
downstream ENSMUSE00000127809 Chr16:4611280..4611456 No primer for this exon
downstream ENSMUSE00000127808 Chr16:4611533..4611666 No primer for this exon
downstream ENSMUSE00000127810 Chr16:4611751..4611869 No primer for this exon
downstream ENSMUSE00000375737 Chr16:4613386..4615957 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAGCCCTTCCTGGCTAAT Chr16:4594971..4594991 62.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCGCATCCTTTCTATTCCT Chr16:4594931..4594951 59.81 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014303