Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15994
Trapped Gene
Arrdc4 (ENSMUSG00000042659)
Vector Insertion
Chr 7: 75887561 - 75889667
Public Clones not available
Private Clones OST468427 (lexicon)
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000261458 (Chr7:75889668..75889815 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGAGAGCTCCAGGTTGTC Chr7:75889701..75889720 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000261458 (Chr7:75889668..75889815 -)
Downstram Exon
ENSMUSE00000261450 (Chr7:75887458..75887560 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGAGAGCTCCAGGTTGTC Chr7:75889701..75889720 59.99 60 CTCGATCTTGACGCTCAGTG Chr7:75887455..75887474 59.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411167 Chr7:75893655..75894124 GGGGCTAGTGTTCGAAGATG Chr7:75893883..75893902 59.69 55
upstream ENSMUSE00000716448 Chr7:75893655..75894074 GGGGCTAGTGTTCGAAGATG Chr7:75893883..75893902 59.69 55
upstream ENSMUSE00000261470 Chr7:75890031..75890097 ACGAGTTTCCCTTTCGCTTT Chr7:75890045..75890064 60.24 45
upstream ENSMUSE00000261458 Chr7:75889668..75889815 GACGAGAGCTCCAGGTTGTC Chr7:75889701..75889720 59.99 60

*** Putative Vector Insertion (Chr 7: 75887561 - 75889667) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000261450 Chr7:75887458..75887560 CTCGATCTTGACGCTCAGTG Chr7:75887455..75887474 59.73 55
downstream ENSMUSE00000490496 Chr7:75886531..75886787 GTCCGTACTCCCAGAACCAA Chr7:75886596..75886615 59.97 55
downstream ENSMUSE00000713970 Chr7:75886489..75886787 GTCCGTACTCCCAGAACCAA Chr7:75886596..75886615 59.97 55
downstream ENSMUSE00000530695 Chr7:75885841..75886003 TACTGAACTGGCTTGCGACA Chr7:75885864..75885883 60.6 50
downstream ENSMUSE00000530694 Chr7:75884771..75884925 CTTCCCCGTCACAGTCAGAG Chr7:75884814..75884833 60.85 60
downstream ENSMUSE00000592656 Chr7:75881880..75884419 CTGAACGAATGCTCCACTGA Chr7:75882835..75882854 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACGTGGATGTCAACACACC Chr7:75889676..75889696 60.93 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACGTGGATGTCAACACACC Chr7:75889676..75889696 60.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042659