Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15998
Trapped Gene
Qrich1 (ENSMUSG00000006673)
Vector Insertion
Chr 9: 108458402 - 108458738
Public Clones not available
Private Clones OST468399 (lexicon) OST458531 (lexicon) OST39237 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221414 (Chr9:108458293..108458401 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221414 (Chr9:108458293..108458401 +)
Downstram Exon
ENSMUSE00000221413 (Chr9:108458739..108458890 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634279 Chr9:108419445..108419571 No primer for this exon
upstream ENSMUSE00000706684 Chr9:108421034..108421157 No primer for this exon
upstream ENSMUSE00000634278 Chr9:108430920..108431249 No primer for this exon
upstream ENSMUSE00000529736 Chr9:108435918..108436949 No primer for this exon
upstream ENSMUSE00000221410 Chr9:108444019..108444196 No primer for this exon
upstream ENSMUSE00000221407 Chr9:108444763..108444917 No primer for this exon
upstream ENSMUSE00000221412 Chr9:108447194..108447308 No primer for this exon
upstream ENSMUSE00000690627 Chr9:108447194..108447331 No primer for this exon
upstream ENSMUSE00000221414 Chr9:108458293..108458401 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108458402 - 108458738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221413 Chr9:108458739..108458890 No primer for this exon
downstream ENSMUSE00000241661 Chr9:108459289..108459379 No primer for this exon
downstream ENSMUSE00000583243 Chr9:108461577..108462491 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGCAGCTACCCAGTGACGA Chr9:108458426..108458446 59.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGCAGCTACCCAGTGACGA Chr9:108458426..108458446 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006673