Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16
Trapped Gene
Rhoa (ENSMUSG00000007815)
Vector Insertion
Chr 9: 108217714 - 108229914
Public Clones GC0283 (tigem) AY0809 (sanger) AZ0734 (sanger) (sanger) CE0137 (sanger)
RSZ540 (baygenomics) P114H06 (ggtc) W223D03 (ggtc) E063E10 (ggtc)
P104F11 (ggtc) D021E02 (ggtc) P089G02 (ggtc) P137B04 (ggtc) 5SP126D02 (ggtc)
P137B04 (ggtc) F017D02 (ggtc) D162E10 (ggtc) (ggtc) A050B02 (ggtc)
D021E02 (ggtc) P002D04 (ggtc) P104F11 (ggtc) 3SP126D02 (ggtc) P141D04 (ggtc)
W168A05 (ggtc) D060F07 (ggtc) P089F08 (ggtc) P141D04 (ggtc) CMHD-GT_269B8-3 (cmhd)
PST3454-NR (escells) PSTVU01.E1ER (vanderbilt) IST15056E3 (tigm)
Private Clones OST466044 (lexicon) OST450306 (lexicon) OST378277 (lexicon) OST375538 (lexicon)
OST330072 (lexicon) OST316167 (lexicon) OST298586 (lexicon) OST294819 (lexicon)
OST265055 (lexicon) OST264443 (lexicon) OST193833 (lexicon) OST184577 (lexicon)
OST169771 (lexicon) OST130252 (lexicon) OST125383 (lexicon) OST122664 (lexicon)
OST115758 (lexicon) OST102916 (lexicon) OST101823 (lexicon) OST93025 (lexicon)
OST33542 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000244569 (Chr9:108217639..108217713 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000244569 (Chr9:108217639..108217713 +)
Downstram Exon
ENSMUSE00000244545 (Chr9:108229915..108230072 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000244596 Chr9:108208754..108208884 No primer for this exon
upstream ENSMUSE00000244569 Chr9:108217639..108217713 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108217714 - 108229914) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000244545 Chr9:108229915..108230072 No primer for this exon
downstream ENSMUSE00000529791 Chr9:108233202..108233322 No primer for this exon
downstream ENSMUSE00000529790 Chr9:108237382..108237512 No primer for this exon
downstream ENSMUSE00000221577 Chr9:108238979..108239742 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCCAAGGCTTTGCACATA Chr9:108217735..108217755 60.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGCCAGAGGACGTGACTG Chr9:108217753..108217773 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007815