Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI160
Trapped Gene
Ncor1 (ENSMUSG00000018501)
Vector Insertion
Chr 11: 62131533 - 62132867
Public Clones GC0153 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000105660 (Chr11:62132868..62133044 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000105660 (Chr11:62132868..62133044 -)
Downstram Exon
ENSMUSE00000677693 (Chr11:62130192..62131532 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431150 Chr11:62270650..62270825 No primer for this exon
upstream ENSMUSE00000589511 Chr11:62270650..62270834 No primer for this exon
upstream ENSMUSE00000677730 Chr11:62251840..62251990 No primer for this exon
upstream ENSMUSE00000718450 Chr11:62251840..62252017 No primer for this exon
upstream ENSMUSE00000718970 Chr11:62251840..62252017 No primer for this exon
upstream ENSMUSE00000722010 Chr11:62251840..62252017 No primer for this exon
upstream ENSMUSE00000340453 Chr11:62247065..62247201 No primer for this exon
upstream ENSMUSE00000677727 Chr11:62247065..62247201 No primer for this exon
upstream ENSMUSE00000390976 Chr11:62236377..62236569 No primer for this exon
upstream ENSMUSE00000677726 Chr11:62236377..62236569 No primer for this exon
upstream ENSMUSE00000237832 Chr11:62233100..62233282 No primer for this exon
upstream ENSMUSE00000677725 Chr11:62233100..62233282 No primer for this exon
upstream ENSMUSE00000503097 Chr11:62224322..62224435 No primer for this exon
upstream ENSMUSE00000677724 Chr11:62224322..62224435 No primer for this exon
upstream ENSMUSE00000105668 Chr11:62217912..62217968 No primer for this exon
upstream ENSMUSE00000677723 Chr11:62217912..62217968 No primer for this exon
upstream ENSMUSE00000105674 Chr11:62217301..62217353 No primer for this exon
upstream ENSMUSE00000677722 Chr11:62217301..62217353 No primer for this exon
upstream ENSMUSE00000652363 Chr11:62216938..62216964 No primer for this exon
upstream ENSMUSE00000589508 Chr11:62214885..62216964 No primer for this exon
upstream ENSMUSE00000398038 Chr11:62214703..62214769 No primer for this exon
upstream ENSMUSE00000677721 Chr11:62214703..62214769 No primer for this exon
upstream ENSMUSE00000105712 Chr11:62211767..62211939 No primer for this exon
upstream ENSMUSE00000677720 Chr11:62211767..62211939 No primer for this exon
upstream ENSMUSE00000376902 Chr11:62208640..62208730 No primer for this exon
upstream ENSMUSE00000652370 Chr11:62208640..62208730 No primer for this exon
upstream ENSMUSE00000105713 Chr11:62206007..62206185 No primer for this exon
upstream ENSMUSE00000710255 Chr11:62206007..62206185 No primer for this exon
upstream ENSMUSE00000716019 Chr11:62206007..62206185 No primer for this exon
upstream ENSMUSE00000411290 Chr11:62204481..62204535 No primer for this exon
upstream ENSMUSE00000677718 Chr11:62204481..62204535 No primer for this exon
upstream ENSMUSE00000105683 Chr11:62203193..62203294 No primer for this exon
upstream ENSMUSE00000677717 Chr11:62203193..62203294 No primer for this exon
upstream ENSMUSE00000652359 Chr11:62198220..62198344 No primer for this exon
upstream ENSMUSE00000708339 Chr11:62198220..62198344 No primer for this exon
upstream ENSMUSE00000717987 Chr11:62198220..62198344 No primer for this exon
upstream ENSMUSE00000431066 Chr11:62196663..62196877 No primer for this exon
upstream ENSMUSE00000677716 Chr11:62196663..62196877 No primer for this exon
upstream ENSMUSE00000431059 Chr11:62194910..62194972 No primer for this exon
upstream ENSMUSE00000677715 Chr11:62194910..62194972 No primer for this exon
upstream ENSMUSE00000431053 Chr11:62192017..62192156 No primer for this exon
upstream ENSMUSE00000652380 Chr11:62191999..62192156 No primer for this exon
upstream ENSMUSE00000677714 Chr11:62191999..62192156 No primer for this exon
upstream ENSMUSE00000431046 Chr11:62190137..62190263 No primer for this exon
upstream ENSMUSE00000677713 Chr11:62190137..62190263 No primer for this exon
upstream ENSMUSE00000431184 Chr11:62186578..62187124 No primer for this exon
upstream ENSMUSE00000652368 Chr11:62186578..62187076 No primer for this exon
upstream ENSMUSE00000652378 Chr11:62186578..62187124 No primer for this exon
upstream ENSMUSE00000431039 Chr11:62182796..62182925 No primer for this exon
upstream ENSMUSE00000677712 Chr11:62182796..62182925 No primer for this exon
upstream ENSMUSE00000431033 Chr11:62180466..62180661 No primer for this exon
upstream ENSMUSE00000677711 Chr11:62180466..62180661 No primer for this exon
upstream ENSMUSE00000677692 Chr11:62180446..62180661 No primer for this exon
upstream ENSMUSE00000589510 Chr11:62173263..62173436 No primer for this exon
upstream ENSMUSE00000677728 Chr11:62173263..62173293 No primer for this exon
upstream ENSMUSE00000399402 Chr11:62172357..62172517 No primer for this exon
upstream ENSMUSE00000720590 Chr11:62172357..62172517 No primer for this exon
upstream ENSMUSE00000720734 Chr11:62172357..62172517 No primer for this exon
upstream ENSMUSE00000105699 Chr11:62168073..62168190 No primer for this exon
upstream ENSMUSE00000677690 Chr11:62168073..62168190 No primer for this exon
upstream ENSMUSE00000652377 Chr11:62167885..62167974 No primer for this exon
upstream ENSMUSE00000105665 Chr11:62167873..62167974 No primer for this exon
upstream ENSMUSE00000105662 Chr11:62166736..62166836 No primer for this exon
upstream ENSMUSE00000677689 Chr11:62166736..62166836 No primer for this exon
upstream ENSMUSE00000105663 Chr11:62164880..62165048 No primer for this exon
upstream ENSMUSE00000677688 Chr11:62164880..62165048 No primer for this exon
upstream ENSMUSE00000652376 Chr11:62162897..62162995 No primer for this exon
upstream ENSMUSE00000431006 Chr11:62162855..62162995 No primer for this exon
upstream ENSMUSE00000105703 Chr11:62158737..62158820 No primer for this exon
upstream ENSMUSE00000677687 Chr11:62158737..62158820 No primer for this exon
upstream ENSMUSE00000677686 Chr11:62158134..62158390 No primer for this exon
upstream ENSMUSE00000718524 Chr11:62158134..62158390 No primer for this exon
upstream ENSMUSE00000721941 Chr11:62158134..62158390 No primer for this exon
upstream ENSMUSE00000105695 Chr11:62156499..62156853 No primer for this exon
upstream ENSMUSE00000677708 Chr11:62156499..62156853 No primer for this exon
upstream ENSMUSE00000105723 Chr11:62153910..62154131 No primer for this exon
upstream ENSMUSE00000677707 Chr11:62153910..62154131 No primer for this exon
upstream ENSMUSE00000237625 Chr11:62152361..62152567 No primer for this exon
upstream ENSMUSE00000467726 Chr11:62152361..62152570 No primer for this exon
upstream ENSMUSE00000677706 Chr11:62152361..62152570 No primer for this exon
upstream ENSMUSE00000105715 Chr11:62151601..62151750 No primer for this exon
upstream ENSMUSE00000677705 Chr11:62151601..62151750 No primer for this exon
upstream ENSMUSE00000237610 Chr11:62151047..62151196 No primer for this exon
upstream ENSMUSE00000677704 Chr11:62151047..62151196 No primer for this exon
upstream ENSMUSE00000237603 Chr11:62147998..62148163 No primer for this exon
upstream ENSMUSE00000677703 Chr11:62147998..62148163 No primer for this exon
upstream ENSMUSE00000677729 Chr11:62147522..62147658 No primer for this exon
upstream ENSMUSE00000105691 Chr11:62147165..62147658 No primer for this exon
upstream ENSMUSE00000677702 Chr11:62147165..62147658 No primer for this exon
upstream ENSMUSE00000105710 Chr11:62144298..62144426 No primer for this exon
upstream ENSMUSE00000677701 Chr11:62144298..62144426 No primer for this exon
upstream ENSMUSE00000105698 Chr11:62143478..62143641 No primer for this exon
upstream ENSMUSE00000677700 Chr11:62143478..62143641 No primer for this exon
upstream ENSMUSE00000105673 Chr11:62142943..62143154 No primer for this exon
upstream ENSMUSE00000677699 Chr11:62142943..62143154 No primer for this exon
upstream ENSMUSE00000105686 Chr11:62140608..62140751 No primer for this exon
upstream ENSMUSE00000589509 Chr11:62140608..62140748 No primer for this exon
upstream ENSMUSE00000677698 Chr11:62140608..62140751 No primer for this exon
upstream ENSMUSE00000105692 Chr11:62138989..62139131 No primer for this exon
upstream ENSMUSE00000677697 Chr11:62138989..62139131 No primer for this exon
upstream ENSMUSE00000105676 Chr11:62134894..62134947 No primer for this exon
upstream ENSMUSE00000677696 Chr11:62134894..62134947 No primer for this exon
upstream ENSMUSE00000105716 Chr11:62134498..62134719 No primer for this exon
upstream ENSMUSE00000677695 Chr11:62134498..62134719 No primer for this exon
upstream ENSMUSE00000105660 Chr11:62132868..62133044 No primer for this exon
upstream ENSMUSE00000677694 Chr11:62132868..62133044 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62131533 - 62132867) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000519699 Chr11:62131338..62131532 No primer for this exon
downstream ENSMUSE00000430535 Chr11:62130192..62131532 No primer for this exon
downstream ENSMUSE00000677693 Chr11:62130192..62131532 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCAGTGCTTAATCGCCTTG Chr11:62132805..62132825 58.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000018501