Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16008
Trapped Gene
Zfp97 (ENSMUSG00000067034)
Vector Insertion
Chr 17: 17221960 - 17222484
Public Clones not available
Private Clones OST468165 (lexicon) OST439612 (lexicon) OST434996 (lexicon) OST321321 (lexicon)
OST299787 (lexicon) OST299717 (lexicon) OST276573 (lexicon) OST232372 (lexicon)
OST170431 (lexicon) OST162172 (lexicon) OST141912 (lexicon) OST105470 (lexicon)
OST62114 (lexicon) OST53615 (lexicon) OST39626 (lexicon) OST38913 (lexicon)
OST38012 (lexicon) OST37246 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703485 (Chr17:17221953..17221959 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703485 (Chr17:17221953..17221959 +)
Downstram Exon
ENSMUSE00000658216 (Chr17:17222485..17222611 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAAAGCCCATTCTTCCTGAG Chr17:17222544..17222563 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703501 Chr17:17214126..17214155 No primer for this exon
upstream ENSMUSE00000703488 Chr17:17221711..17221730 No primer for this exon
upstream ENSMUSE00000703496 Chr17:17221711..17221730 No primer for this exon
upstream ENSMUSE00000703485 Chr17:17221953..17221959 No primer for this exon
upstream ENSMUSE00000703493 Chr17:17221953..17221959 No primer for this exon

*** Putative Vector Insertion (Chr 17: 17221960 - 17222484) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578014 Chr17:17222485..17222611 CAAAGCCCATTCTTCCTGAG Chr17:17222544..17222563 59.81 50
downstream ENSMUSE00000658216 Chr17:17222485..17222611 CAAAGCCCATTCTTCCTGAG Chr17:17222544..17222563 59.81 50
downstream ENSMUSE00000613608 Chr17:17222854..17222914 TGGGTCTTCCAGAATTTTCA Chr17:17222913..17222932 58.12 40
downstream ENSMUSE00000577995 Chr17:17224208..17226592 CACTGCATTATCCGGGTTTT Chr17:17226481..17226500 59.82 45
downstream ENSMUSE00000658214 Chr17:17224208..17225028 TTTCTTGCAAAGGCTCCATC Chr17:17224291..17224310 60.33 45
downstream ENSMUSE00000658212 Chr17:17226206..17226593 CACTGCATTATCCGGGTTTT Chr17:17226481..17226500 59.82 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr17:17222011..17222031 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000067034