Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16010
Trapped Gene
Reep3 (ENSMUSG00000019873)
Vector Insertion
Chr 10: 66477796 - 66484496
Public Clones IST13016D3 (tigm) IST12339C4 (tigm) IST12639G11 (tigm) IST10871B3 (tigm)
IST11064C10 (tigm) IST12339C4 (tigm) IST12767H10 (tigm) IST11064C10 (tigm)
Private Clones OST468105 (lexicon) OST429536 (lexicon) OST368103 (lexicon) OST333061 (lexicon)
OST333041 (lexicon)
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098748 (Chr10:66484497..66484641 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098748 (Chr10:66484497..66484641 -)
Downstram Exon
ENSMUSE00000098747 (Chr10:66477650..66477795 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000575839 Chr10:66559538..66559655 No primer for this exon
upstream ENSMUSE00000575838 Chr10:66525747..66525819 No primer for this exon
upstream ENSMUSE00000289962 Chr10:66502249..66502325 No primer for this exon
upstream ENSMUSE00000367558 Chr10:66498633..66498753 No primer for this exon
upstream ENSMUSE00000575837 Chr10:66497347..66497460 No primer for this exon
upstream ENSMUSE00000098748 Chr10:66484497..66484641 No primer for this exon

*** Putative Vector Insertion (Chr 10: 66477796 - 66484496) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098747 Chr10:66477650..66477795 No primer for this exon
downstream ENSMUSE00000575834 Chr10:66476432..66476534 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGATAATCGCCTTGCAGCAC Chr10:66484428..66484449 60.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCATTCCCTGCTTCCTGAG Chr10:66484447..66484467 59.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATCTAATCGCCTTGCAGCAC Chr10:66484574..66484594 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGAGCCAAGGAGCAATAACG Chr10:66484622..66484642 59.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019873