Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16012
Trapped Gene
Hook3 (ENSMUSG00000037234)
Vector Insertion
Chr 8: 27169853 - 27171848
Public Clones (sanger) D093F07 (ggtc) E005D02 (ggtc) IST13066G6 (tigm) IST14806G5 (tigm)
Private Clones OST468067 (lexicon) OST433194 (lexicon) OST243644 (lexicon) OST200040 (lexicon)
OST172909 (lexicon) OST151477 (lexicon) OST55541 (lexicon)
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251083 (Chr8:27171849..27171918 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTTGCAGCAGAGATTGT Chr8:27171864..27171883 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251083 (Chr8:27171849..27171918 -)
Downstram Exon
ENSMUSE00000251075 (Chr8:27169712..27169852 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTTGCAGCAGAGATTGT Chr8:27171864..27171883 60.16 50 CTGTTCTCCGTCTCCAGCTC Chr8:27169690..27169709 60.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477146 Chr8:27229430..27229642 CTGGTTGGTTGAAGGGAGAC Chr8:27229507..27229526 59.55 55
upstream ENSMUSE00000251091 Chr8:27221208..27221293 TTGTCATGTCCCAGGTTCTTC Chr8:27221215..27221235 59.96 47.62
upstream ENSMUSE00000449086 Chr8:27206230..27206302 TTCGACGATAATTGGCTAAACA Chr8:27206268..27206289 59.62 36.36
upstream ENSMUSE00000523228 Chr8:27204129..27204179 No primer for this exon
upstream ENSMUSE00000251159 Chr8:27198532..27198664 ATTTCACCCTTCCTGACGTG Chr8:27198623..27198642 59.97 50
upstream ENSMUSE00000251155 Chr8:27192986..27193053 GTCGTCATGACAGCCATTCA Chr8:27192990..27193009 60.7 50
upstream ENSMUSE00000251149 Chr8:27185340..27185402 GTCTCTGCTGGACATGATGC Chr8:27185362..27185381 59.38 55
upstream ENSMUSE00000251139 Chr8:27184072..27184155 TTGCTCAAAGATGCCATGAA Chr8:27184084..27184103 60.34 40
upstream ENSMUSE00000464055 Chr8:27182729..27182892 CAATAGCCCAGCAGGAAGAA Chr8:27182781..27182800 60.34 50
upstream ENSMUSE00000251242 Chr8:27181530..27181670 CAGCAGAACGATGAGCTGAC Chr8:27181581..27181600 59.73 55
upstream ENSMUSE00000251236 Chr8:27180546..27180747 GGCAGGTTAAGCTCTTGGAA Chr8:27180645..27180664 59.45 50
upstream ENSMUSE00000251230 Chr8:27179031..27179141 GCGGCTAAAAGAAAAAGTTGA Chr8:27179053..27179073 58.69 38.1
upstream ENSMUSE00000251223 Chr8:27178322..27178409 AAGAGTTGCGTTGTGTGCAG Chr8:27178350..27178369 60.1 50
upstream ENSMUSE00000251083 Chr8:27171849..27171918 AGCCTTGCAGCAGAGATTGT Chr8:27171864..27171883 60.16 50

*** Putative Vector Insertion (Chr 8: 27169853 - 27171848) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251075 Chr8:27169712..27169852 CTGTTCTCCGTCTCCAGCTC Chr8:27169690..27169709 60.13 60
downstream ENSMUSE00000251219 Chr8:27158724..27158811 TTTGAACCTTGATCCTGCAA Chr8:27158712..27158731 59.25 40
downstream ENSMUSE00000251213 Chr8:27154712..27154746 No primer for this exon
downstream ENSMUSE00000251207 Chr8:27150141..27150223 TGCAATTCATTGTTGGCTTC Chr8:27150169..27150188 59.67 40
downstream ENSMUSE00000251199 Chr8:27148494..27148594 TCTTCCGTAAAGCCTCTTGC Chr8:27148534..27148553 59.59 50
downstream ENSMUSE00000251193 Chr8:27145605..27145709 TTCTGGTGCTGCTCCTTGAT Chr8:27145640..27145659 60.94 50
downstream ENSMUSE00000251184 Chr8:27145403..27145474 No primer for this exon
downstream ENSMUSE00000523227 Chr8:27139381..27142502 TGGTGACAGGTCCTCCCTAC Chr8:27139414..27139433 59.96 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCTTGCAGCAGAGATTGT Chr8:27171862..27171882 60.16 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTTGCAGCAGAGATTGT Chr8:27171862..27171882 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCCTTGACTTTGCCTCTCC Chr8:27171929..27171949 59.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCAGACGTGACTGGGAAAAC Chr8:27171853..27171873 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037234