Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16014
Trapped Gene
B230112C05Rik (ENSMUSG00000041817)
Vector Insertion
Chr 13: 97884215 - 97888329
Public Clones E039E07 (ggtc) CMHD-GT_510F5-3 (cmhd)
Private Clones OST467990 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297775 (Chr13:97884064..97884214 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCTGTTTCCACGCGTACT Chr13:97884076..97884095 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297775 (Chr13:97884064..97884214 +)
Downstram Exon
ENSMUSE00000297771 (Chr13:97888330..97888486 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCTGTTTCCACGCGTACT Chr13:97884076..97884095 60.31 55 CTCTGATGTTCGTGCAGCAT Chr13:97888360..97888379 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611533 Chr13:97841598..97841666 No primer for this exon
upstream ENSMUSE00000297815 Chr13:97861773..97861907 GATAACTGCACGCATGAGGA Chr13:97861800..97861819 59.83 50
upstream ENSMUSE00000297810 Chr13:97863546..97863645 TTTGCGCCTGAAGATTCTCT Chr13:97863621..97863640 60.1 45
upstream ENSMUSE00000297805 Chr13:97864017..97864102 GGTGGGCCATTGATGATATT Chr13:97864044..97864063 59.47 45
upstream ENSMUSE00000297802 Chr13:97867495..97867666 GAGGCCGTTGGGTTTTATTC Chr13:97867633..97867652 60.67 50
upstream ENSMUSE00000569672 Chr13:97876909..97877088 TGGCTTACGGTACCCACTGT Chr13:97877051..97877070 60.43 55
upstream ENSMUSE00000569671 Chr13:97879978..97880106 GTACCAGTCACCCGAGCATT Chr13:97880061..97880080 60 55
upstream ENSMUSE00000297785 Chr13:97881251..97881357 ACCTGGACTGGACGACACTC Chr13:97881321..97881340 60.16 60
upstream ENSMUSE00000297780 Chr13:97883594..97883633 TGCCTTTGCTAGCACTTCTG Chr13:97883611..97883630 59.37 50
upstream ENSMUSE00000297775 Chr13:97884064..97884214 CTCCTGTTTCCACGCGTACT Chr13:97884076..97884095 60.31 55

*** Putative Vector Insertion (Chr 13: 97884215 - 97888329) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297771 Chr13:97888330..97888486 CTCTGATGTTCGTGCAGCAT Chr13:97888360..97888379 60.02 50
downstream ENSMUSE00000297764 Chr13:97892647..97892847 CTGGTGGAGTCCTCGTCTTC Chr13:97892735..97892754 59.83 60
downstream ENSMUSE00000397821 Chr13:97896451..97899470 GGCGCGTCTTCAAGTTCTAC Chr13:97896782..97896801 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCACTCGCACTCTGTCGT Chr13:97884232..97884252 59.76 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTTGCTTCTCGTGACTGG Chr13:97884255..97884275 60.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041817