Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16019
Trapped Gene
Zfp592 (ENSMUSG00000005621)
Vector Insertion
Chr 7: 88168156 - 88170396
Public Clones not available
Private Clones OST467821 (lexicon) OST464638 (lexicon) OST462880 (lexicon) OST454755 (lexicon)
OST450013 (lexicon) OST448507 (lexicon) OST442466 (lexicon) OST433242 (lexicon)
OST389292 (lexicon) OST385519 (lexicon) OST369360 (lexicon) OST368863 (lexicon)
OST354844 (lexicon) OST332369 (lexicon) OST325411 (lexicon) OST319261 (lexicon)
OST313733 (lexicon) OST307659 (lexicon) OST288982 (lexicon) OST249156 (lexicon)
OST241449 (lexicon) OST225860 (lexicon) OST216724 (lexicon) OST195628 (lexicon)
OST164857 (lexicon) OST135508 (lexicon) OST123579 (lexicon) OST101513 (lexicon)
OST90308 (lexicon) OST82449 (lexicon) OST78798 (lexicon) OST66112 (lexicon)
OST55249 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313250 (Chr7:88168157..88170395 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313250 (Chr7:88168157..88170395 +)
Downstram Exon
ENSMUSE00000711051 (Chr7:88168157..88170395 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672819 Chr7:88138570..88138648 No primer for this exon
upstream ENSMUSE00000672825 Chr7:88138598..88138648 No primer for this exon
upstream ENSMUSE00000633904 Chr7:88154320..88154425 No primer for this exon

*** Putative Vector Insertion (Chr 7: 88168156 - 88170396) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000313250 Chr7:88168157..88170395 No primer for this exon
downstream ENSMUSE00000711051 Chr7:88168157..88170395 No primer for this exon
downstream ENSMUSE00000152596 Chr7:88174335..88174513 No primer for this exon
downstream ENSMUSE00000152590 Chr7:88182236..88182412 No primer for this exon
downstream ENSMUSE00000152595 Chr7:88182691..88182850 No primer for this exon
downstream ENSMUSE00000152593 Chr7:88182950..88183237 No primer for this exon
downstream ENSMUSE00000152592 Chr7:88183439..88183551 No primer for this exon
downstream ENSMUSE00000152594 Chr7:88184016..88184151 No primer for this exon
downstream ENSMUSE00000384796 Chr7:88186234..88187581 No primer for this exon
downstream ENSMUSE00000672820 Chr7:88186234..88190050 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGAGGCCCTGCTGGTAAT Chr7:88168111..88168131 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGATCGTGACTGGGAAAA Chr7:88168201..88168221 59.1 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005621