Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16024
Trapped Gene
Scamp5 (ENSMUSG00000040722)
Vector Insertion
Chr 9: 57299842 - 57315739
Public Clones (sanger) (ggtc) (ggtc) IST14521A7 (tigm) IST14157E3 (tigm) IST15000B12 (tigm)
IST11548D2 (tigm) IST14239A9 (tigm) IST14294D11 (tigm)
Private Clones OST467737 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698497 (Chr9:57315740..57315831 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698497 (Chr9:57315740..57315831 -)
Downstram Exon
ENSMUSE00000698496 (Chr9:57299787..57299841 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCAGCTCAGTAAGCCTGCTC Chr9:57299782..57299801 60.3 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698497 Chr9:57315740..57315831 No primer for this exon

*** Putative Vector Insertion (Chr 9: 57299842 - 57315739) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000698496 Chr9:57299787..57299841 CCAGCTCAGTAAGCCTGCTC Chr9:57299782..57299801 60.3 60
downstream ENSMUSE00000259955 Chr9:57299163..57299291 ATGCTGAGGAGGGATGTCTG Chr9:57299178..57299197 60.22 55
downstream ENSMUSE00000464354 Chr9:57294884..57295040 AGCAGACGTAGGAGCAAGGT Chr9:57294890..57294909 59.12 55
downstream ENSMUSE00000486096 Chr9:57293879..57293980 TGAGCCATGAAGGTGAAGAA Chr9:57293908..57293927 59.37 45
downstream ENSMUSE00000259900 Chr9:57293179..57293296 TTCGTCCCGAAGAAGGAAAT Chr9:57293239..57293258 60.93 45
downstream ENSMUSE00000636581 Chr9:57289135..57291671 CAGGAAGTTGACTGGGGGTA Chr9:57289496..57289515 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr9:57306671..57306691 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACGACGTGACTGGGAAAAC Chr9:57306673..57306694 59.65 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTAGTCTGCAGGGCAGAGG Chr9:57306837..57306857 60.15 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTTGCGTGACTGGGAAAAC Chr9:57306766..57306786 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040722