Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16036
Trapped Gene
Mllt11 (ENSMUSG00000053192)
Vector Insertion
Chr 3: 95024386 - 95032005
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) E021G07 (ggtc) E017D09 (ggtc) 5SE287F02 (ggtc)
IST14484A3 (tigm) IST14498E10 (tigm) IST12622B2 (tigm) IST12237D6 (tigm)
IST14698F12 (tigm) IST12463E7 (tigm) IST12463E7 (tigm) IST14534A4 (tigm)
IST14344F6 (tigm) IST14637D1 (tigm) IST14621G8 (tigm) IST14888A8 (tigm)
IST14578A5 (tigm)
Private Clones OST467464 (lexicon) OST300668 (lexicon) OST299465 (lexicon) OST293141 (lexicon)
OST286215 (lexicon) OST230404 (lexicon) OST230287 (lexicon) OST224932 (lexicon)
OST208519 (lexicon) OST180270 (lexicon) OST174756 (lexicon) OST171813 (lexicon)
OST170980 (lexicon) OST169504 (lexicon) OST169455 (lexicon) OST134381 (lexicon)
OST133639 (lexicon) OST132460 (lexicon) OST119461 (lexicon) OST107339 (lexicon)
OST91909 (lexicon) OST91505 (lexicon) OST86039 (lexicon) OST65871 (lexicon)
OST32744 (lexicon) OST24317 (lexicon) OST16669 (lexicon) OST6109 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503982 (Chr3:95032006..95032225 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGGCGTGAGGAGACAAAG Chr3:95032125..95032144 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503982 (Chr3:95032006..95032225 -)
Downstram Exon
ENSMUSE00000434271 (Chr3:95023059..95024385 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGGCGTGAGGAGACAAAG Chr3:95032125..95032144 59.99 55 TAACTGCCTGCGTGTTTCTG Chr3:95023492..95023511 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503982 Chr3:95032006..95032225 GAAGGCGTGAGGAGACAAAG Chr3:95032125..95032144 59.99 55

*** Putative Vector Insertion (Chr 3: 95024386 - 95032005) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434271 Chr3:95023059..95024385 TAACTGCCTGCGTGTTTCTG Chr3:95023492..95023511 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGAAAGACCCCGTGTGAG Chr3:95031955..95031975 60.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGAGACGTGACTGGGAAA Chr3:95031941..95031961 60.28 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CACTGAGGCCCCAGACTCTA Chr3:95032246..95032266 60.4 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CACTGAGGCCCCAGACTCTA Chr3:95032246..95032266 60.4 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053192