Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1604
Trapped Gene
Manbal (ENSMUSG00000063019)
Vector Insertion
Chr 2: 157204991 - 157221645
Public Clones BC0937 (sanger) AH0319 (sanger) RRU613 (baygenomics) D053G07 (ggtc)
D159G11 (ggtc) P082D12 (ggtc) D053G07 (ggtc) P075B11 (ggtc) CMHD-GT_285G6-3 (cmhd)
CMHD-GT_503D12-3 (cmhd) CMHD-GT_372D6-3 (cmhd) CMHD-GT_453G2-3 (cmhd) CMHD-GT_349G11-3 (cmhd)
IST10613C11 (tigm) IST10945B9 (tigm) IST12240F3 (tigm) IST12940C11 (tigm)
Private Clones OST438870 (lexicon) OST425533 (lexicon) OST407156 (lexicon) OST340589 (lexicon)
OST293018 (lexicon) OST289260 (lexicon) OST284309 (lexicon) OST249884 (lexicon)
OST200472 (lexicon) OST179998 (lexicon) OST93089 (lexicon) OST66133 (lexicon)
OST46464 (lexicon) OST35568 (lexicon) OST7400 (lexicon)
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000468800 (Chr2:157204785..157204990 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGCTGGAGAGTGGTGAAT Chr2:157204790..157204809 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000468800 (Chr2:157204785..157204990 +)
Downstram Exon
ENSMUSE00000469751 (Chr2:157221646..157222498 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGCTGGAGAGTGGTGAAT Chr2:157204790..157204809 60.12 55 CACAGCTGGAGCCTAAGGAC Chr2:157221929..157221948 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471524 Chr2:157193345..157193376 No primer for this exon
upstream ENSMUSE00000468800 Chr2:157204785..157204990 GGTGCTGGAGAGTGGTGAAT Chr2:157204790..157204809 60.12 55

*** Putative Vector Insertion (Chr 2: 157204991 - 157221645) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000469751 Chr2:157221646..157222498 CACAGCTGGAGCCTAAGGAC Chr2:157221929..157221948 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr2:157217039..157217059 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAGCGTGACTGGGAAAACC Chr2:157217038..157217058 59.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063019