Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16040
Trapped Gene
Fgf18 (ENSMUSG00000057967)
Vector Insertion
Chr 11: 33017447 - 33018032
Public Clones not available
Private Clones OST467407 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680017 (Chr11:33017448..33018031 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGAGGAAACTGCGAGAAA Chr11:33017481..33017500 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680017 (Chr11:33017448..33018031 -)
Downstram Exon
ENSMUSE00000429384 (Chr11:33017430..33018031 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGAGGAAACTGCGAGAAA Chr11:33017481..33017500 59.99 45 CAGGGCCGTGTAGTTGTTTT Chr11:33017944..33017963 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332835 Chr11:33047242..33047400 No primer for this exon
upstream ENSMUSE00000429369 Chr11:33047045..33047081 ACTGCTGTGCTTCCAGGTTC Chr11:33047047..33047066 60.45 55
upstream ENSMUSE00000680016 Chr11:33046695..33046795 GTCAGCCTCGGTAGGGAAAT Chr11:33046767..33046786 60.46 55
upstream ENSMUSE00000102848 Chr11:33034203..33034383 GATGATGTGAGTCGGAAGCA Chr11:33034301..33034320 59.79 50
upstream ENSMUSE00000680015 Chr11:33034203..33034383 GATGATGTGAGTCGGAAGCA Chr11:33034301..33034320 59.79 50
upstream ENSMUSE00000580401 Chr11:33024613..33024719 TATGAACCGAAAAGGCAAGC Chr11:33024624..33024643 60.21 45
upstream ENSMUSE00000680014 Chr11:33024613..33024719 TATGAACCGAAAAGGCAAGC Chr11:33024624..33024643 60.21 45
upstream ENSMUSE00000680017 Chr11:33017448..33018031 AACGAGGAAACTGCGAGAAA Chr11:33017481..33017500 59.99 45

*** Putative Vector Insertion (Chr 11: 33017447 - 33018032) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000429384 Chr11:33017430..33018031 CAGGGCCGTGTAGTTGTTTT Chr11:33017944..33017963 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTGCGTGTTCATTGAGA Chr11:33017993..33018013 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGTGCGTGTTCATTGAGA Chr11:33017993..33018013 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057967