Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16053
Trapped Gene
Gsta2 (ENSMUSG00000057933)
Vector Insertion
Chr 9: 78189746 - 78194895
Public Clones not available
Private Clones OST467082 (lexicon) OST443506 (lexicon) OST423806 (lexicon) OST278942 (lexicon)
OST260500 (lexicon) OST131187 (lexicon) OST96573 (lexicon) OST40441 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000414567 (Chr9:78194896..78194957 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATTGGGAGCTGAGTGGAGA Chr9:78194917..78194936 60.35 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000414567 (Chr9:78194896..78194957 -)
Downstram Exon
ENSMUSE00000218928 (Chr9:78189637..78189745 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATTGGGAGCTGAGTGGAGA Chr9:78194917..78194936 60.35 55 CATTGCAGCAACTGTGGTTC Chr9:78189699..78189718 60.31 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414567 Chr9:78194896..78194957 GATTGGGAGCTGAGTGGAGA Chr9:78194917..78194936 60.35 55

*** Putative Vector Insertion (Chr 9: 78189746 - 78194895) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218928 Chr9:78189637..78189745 CATTGCAGCAACTGTGGTTC Chr9:78189699..78189718 60.31 50
downstream ENSMUSE00000218923 Chr9:78186452..78186503 TCCAAATCTTCCGGACTCTG Chr9:78186444..78186463 60.19 50
downstream ENSMUSE00000531602 Chr9:78185366..78185498 TGGTGGCGATGTAGTTGAGA Chr9:78185384..78185403 60.26 50
downstream ENSMUSE00000487804 Chr9:78181568..78181709 CAAGGCAGTCTTGGCTTCTC Chr9:78181591..78181610 60.13 55
downstream ENSMUSE00000467995 Chr9:78179894..78180025 CCTGTTGCCCACAAGGTAGT Chr9:78179962..78179981 60.03 55
downstream ENSMUSE00000461487 Chr9:78178826..78179056 GAGGCTGCTGATTCTGCTCT Chr9:78179008..78179027 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCACACGCACAAGAAAGTA Chr9:78194853..78194873 59.07 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCACACGCACAAGAAAGTA Chr9:78194853..78194873 59.07 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057933