Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16054
Trapped Gene
Lix1 (ENSMUSG00000047786)
Vector Insertion
Chr 17: 17586102 - 17591223
Public Clones (ggtc) (ggtc) (ggtc) CMHD-GT_436G1-3 (cmhd) CMHD-GT_498F11-3 (cmhd)
Private Clones OST467070 (lexicon) OST447673 (lexicon) OST339093 (lexicon) OST293610 (lexicon)
OST286642 (lexicon) OST260993 (lexicon) OST179702 (lexicon) OST179693 (lexicon)
OST176117 (lexicon) OST175021 (lexicon) OST129420 (lexicon) OST54135 (lexicon)
OST24099 (lexicon) OST17276 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000658211 (Chr17:17586000..17586101 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCAATAGGCTTCAGCTTTC Chr17:17586045..17586064 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000658211 (Chr17:17586000..17586101 +)
Downstram Exon
ENSMUSE00000555243 (Chr17:17591224..17591301 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCAATAGGCTTCAGCTTTC Chr17:17586045..17586064 60.12 50 CGAGAGCACTTTGTTTCACG Chr17:17591300..17591319 59.63 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358111 Chr17:17539650..17539990 ACTGCATCAATGAGCTGCAC Chr17:17539817..17539836 60.02 50
upstream ENSMUSE00000255754 Chr17:17564120..17564283 GAGCTGCTTTGGCAACTTTC Chr17:17564262..17564281 60.14 50
upstream ENSMUSE00000391086 Chr17:17580612..17580752 GAAGCAGTAGCCTCCACCAG Chr17:17580732..17580751 60.01 60
upstream ENSMUSE00000346882 Chr17:17582932..17583027 CACGTTAGATGATGCGGATG Chr17:17582934..17582953 60.1 50
upstream ENSMUSE00000658211 Chr17:17586000..17586101 CGCAATAGGCTTCAGCTTTC Chr17:17586045..17586064 60.12 50

*** Putative Vector Insertion (Chr 17: 17586102 - 17591223) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000555243 Chr17:17591224..17591301 CGAGAGCACTTTGTTTCACG Chr17:17591300..17591319 59.63 50
downstream ENSMUSE00000658210 Chr17:17594070..17596349 GTGGACATTGCCAAACACAG Chr17:17595395..17595414 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAAGATTTAGCAGCGTGT Chr17:17586067..17586087 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAAGATTTAGCAGCGTGT Chr17:17586067..17586087 60.42 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047786