Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16062
Trapped Gene
BC003331 (ENSMUSG00000006010)
Vector Insertion
Chr 1: 152237487 - 152239733
Public Clones (sanger) (sanger) (sanger) (ggtc) IST14551E5 (tigm) IST14555D3 (tigm)
Private Clones OST466941 (lexicon) OST306635 (lexicon) OST287261 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689761 (Chr1:152239734..152239849 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689761 (Chr1:152239734..152239849 -)
Downstram Exon
ENSMUSE00000719079 (Chr1:152237366..152237486 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689784 Chr1:152239820..152240185 No primer for this exon
upstream ENSMUSE00000689760 Chr1:152239734..152239873 No primer for this exon
upstream ENSMUSE00000689761 Chr1:152239734..152239849 No primer for this exon

*** Putative Vector Insertion (Chr 1: 152237487 - 152239733) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000713281 Chr1:152237366..152237486 No primer for this exon
downstream ENSMUSE00000715356 Chr1:152237366..152237486 No primer for this exon
downstream ENSMUSE00000719079 Chr1:152237366..152237486 No primer for this exon
downstream ENSMUSE00000262566 Chr1:152235653..152235787 No primer for this exon
downstream ENSMUSE00000595536 Chr1:152235653..152235787 No primer for this exon
downstream ENSMUSE00000262559 Chr1:152233488..152233583 No primer for this exon
downstream ENSMUSE00000595535 Chr1:152233488..152233583 No primer for this exon
downstream ENSMUSE00000262552 Chr1:152231559..152231665 No primer for this exon
downstream ENSMUSE00000159993 Chr1:152230188..152230224 No primer for this exon
downstream ENSMUSE00000159979 Chr1:152229398..152229538 No primer for this exon
downstream ENSMUSE00000159981 Chr1:152228629..152228724 No primer for this exon
downstream ENSMUSE00000595534 Chr1:152227442..152227507 No primer for this exon
downstream ENSMUSE00000159978 Chr1:152222626..152222754 No primer for this exon
downstream ENSMUSE00000159992 Chr1:152221925..152222015 No primer for this exon
downstream ENSMUSE00000159990 Chr1:152219159..152219329 No primer for this exon
downstream ENSMUSE00000595533 Chr1:152210655..152210728 No primer for this exon
downstream ENSMUSE00000159983 Chr1:152210621..152210728 No primer for this exon
downstream ENSMUSE00000595532 Chr1:152210621..152210652 No primer for this exon
downstream ENSMUSE00000659135 Chr1:152209664..152210018 No primer for this exon
downstream ENSMUSE00000409726 Chr1:152209651..152210018 No primer for this exon
downstream ENSMUSE00000595531 Chr1:152208443..152210018 No primer for this exon
downstream ENSMUSE00000689764 Chr1:152208443..152210018 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTTTTAATCGCCTTGCAG Chr1:152239668..152239688 60.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTTCGTGACTGGGAAAA Chr1:152239668..152239688 60.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTCTGCTGTCGCTTTCTGA Chr1:152239870..152239890 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCTCTGCTGTCGCTTTCTGA Chr1:152239870..152239890 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006010