Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16071
Trapped Gene
Morn3 (ENSMUSG00000029477)
Vector Insertion
Chr 5: 123487370 - 123487684
Public Clones not available
Private Clones OST466844 (lexicon) OST447938 (lexicon) OST431810 (lexicon) OST418821 (lexicon)
OST358428 (lexicon) OST354449 (lexicon) OST292527 (lexicon) OST261014 (lexicon)
OST250866 (lexicon) OST199035 (lexicon) OST133411 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000328409 (Chr5:123487685..123487869 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGAAGGCTACTGGGTGGAC Chr5:123487763..123487782 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000328409 (Chr5:123487685..123487869 -)
Downstram Exon
ENSMUSE00000495618 (Chr5:123487142..123487369 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGAAGGCTACTGGGTGGAC Chr5:123487763..123487782 60.11 55 AGATTTGCCCTCTCTGGTCA Chr5:123487181..123487200 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000497370 Chr5:123496640..123496829 AAAGCCCAGAAGAACGGACT Chr5:123496708..123496727 60.25 50
upstream ENSMUSE00000649828 Chr5:123491092..123491249 GGAAGCGAGATGGTTATGGA Chr5:123491170..123491189 60.04 50
upstream ENSMUSE00000189240 Chr5:123489266..123489425 GTTTTTCGGACCCAAGGAGT Chr5:123489392..123489411 60.34 50
upstream ENSMUSE00000328409 Chr5:123487685..123487869 TTGAAGGCTACTGGGTGGAC Chr5:123487763..123487782 60.11 55

*** Putative Vector Insertion (Chr 5: 123487370 - 123487684) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000495618 Chr5:123487142..123487369 AGATTTGCCCTCTCTGGTCA Chr5:123487181..123487200 59.8 50
downstream ENSMUSE00000537470 Chr5:123487142..123487369 AGATTTGCCCTCTCTGGTCA Chr5:123487181..123487200 59.8 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTAATCGCCTTGCAGCAC Chr5:123487616..123487636 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCCTGAAACCAGAGAAAC Chr5:123487646..123487666 61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029477