Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16074
Trapped Gene
Unc5d (ENSMUSG00000063626)
Vector Insertion
Chr 8: 30001983 - 30329713
Public Clones not available
Private Clones OST466805 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000464418 (Chr8:30329714..30329810 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCCCATGGCTAGGACTCT Chr8:30329747..30329766 60.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000464418 (Chr8:30329714..30329810 -)
Downstram Exon
ENSMUSE00000487609 (Chr8:30001764..30001982 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCCCATGGCTAGGACTCT Chr8:30329747..30329766 60.76 60 ACTCCCCATTGCATTTGAAG Chr8:30001793..30001812 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000464418 Chr8:30329714..30329810 GCTCCCATGGCTAGGACTCT Chr8:30329747..30329766 60.76 60

*** Putative Vector Insertion (Chr 8: 30001983 - 30329713) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487609 Chr8:30001764..30001982 ACTCCCCATTGCATTTGAAG Chr8:30001793..30001812 59.93 45
downstream ENSMUSE00000462329 Chr8:29985968..29986111 CATGGAAGTCCTCCACTTGC Chr8:29986030..29986049 60.66 55
downstream ENSMUSE00000463236 Chr8:29955206..29955309 AGCACGATCATGCCTTCAAT Chr8:29955221..29955240 60.63 45
downstream ENSMUSE00000460315 Chr8:29872171..29872351 GATGGGCTCCTCATTTTTCA Chr8:29872300..29872319 60.01 45
downstream ENSMUSE00000523208 Chr8:29871197..29871364 TCTACCACAGCGAACATTGC Chr8:29871284..29871303 59.87 50
downstream ENSMUSE00000484972 Chr8:29869430..29869594 GAGCTGTGCACTCACGGATA Chr8:29869489..29869508 60.02 55
downstream ENSMUSE00000489647 Chr8:29851952..29851984 GGGGTTTTATTTCATGAAGAGG Chr8:29851933..29851954 58.86 40.91
downstream ENSMUSE00000684312 Chr8:29835620..29835634 No primer for this exon
downstream ENSMUSE00000490558 Chr8:29834693..29834878 AGCCGGAGTACAAAGCAATG Chr8:29834818..29834837 60.27 50
downstream ENSMUSE00000516219 Chr8:29830089..29830466 GTACTGAATCCGCGGTTGTT Chr8:29830189..29830208 60 50
downstream ENSMUSE00000517462 Chr8:29826195..29826279 CTCGGTTCACCTTGGTTGAT Chr8:29826173..29826192 59.97 50
downstream ENSMUSE00000514538 Chr8:29806802..29806970 TCAGGTGAATGTTCCAGTGC Chr8:29806809..29806828 59.68 50
downstream ENSMUSE00000515526 Chr8:29804987..29805214 CTCCTGTGAGGGCATACGTT Chr8:29805087..29805106 60.13 55
downstream ENSMUSE00000512134 Chr8:29793575..29793724 GAACGGTTTGATCCTCCAGA Chr8:29793565..29793584 60.05 50
downstream ENSMUSE00000510393 Chr8:29785747..29785911 GATGGATGTCTGCACTTGGA Chr8:29785731..29785750 59.64 50
downstream ENSMUSE00000511426 Chr8:29777238..29777416 TGTCCTCTTGTGCGAAGAAA Chr8:29777355..29777374 59.57 45
downstream ENSMUSE00000509362 Chr8:29762522..29763444 GAGGGTATAGCGGGGTTCTC Chr8:29763005..29763024 59.92 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTTCCCAGGAACCTCCAG Chr8:30299701..30299721 60.48 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCATTCTCTTTTGCCTGTC Chr8:30299678..30299699 60.01 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063626