Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16102
Trapped Gene
Tbca (ENSMUSG00000042043)
Vector Insertion
Chr 13: 95558958 - 95602314
Public Clones (sanger) (ggtc) (ggtc) IST14259D6 (tigm) IST14564C12 (tigm) IST10949B8 (tigm)
Private Clones OST466517 (lexicon) OST462243 (lexicon) OST393068 (lexicon) OST378302 (lexicon)
OST361547 (lexicon) OST339802 (lexicon) OST311656 (lexicon) OST282144 (lexicon)
OST278546 (lexicon) OST259454 (lexicon) OST257898 (lexicon) OST252705 (lexicon)
OST252663 (lexicon) OST126465 (lexicon) OST85106 (lexicon) OST81155 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301703 (Chr13:95558898..95558957 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301703 (Chr13:95558898..95558957 +)
Downstram Exon
ENSMUSE00000301695 (Chr13:95602315..95602420 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTCTCCATCTTCAGCCTTCA Chr13:95602402..95602422 60.08 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000301703 Chr13:95558898..95558957 No primer for this exon

*** Putative Vector Insertion (Chr 13: 95558958 - 95602314) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301695 Chr13:95602315..95602420 TCTCTCCATCTTCAGCCTTCA Chr13:95602402..95602422 60.08 47.62
downstream ENSMUSE00000301686 Chr13:95607063..95607149 ATCATCATCCGGGACTCTTG Chr13:95607097..95607116 59.89 50
downstream ENSMUSE00000452365 Chr13:95612605..95612852 GACCCCAGGATTTAATGCAA Chr13:95612732..95612751 59.76 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCAAAGACTTGAGTTACCAGA Chr13:95585954..95585977 58.71 43.48 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCAAAGACTTGAGTTACCAGA Chr13:95585954..95585977 58.71 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042043