Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16109
Trapped Gene
Lsm4 (ENSMUSG00000031848)
Vector Insertion
Chr 8: 73201776 - 73201852
Public Clones not available
Private Clones OST466481 (lexicon) OST462359 (lexicon) OST453024 (lexicon) OST443265 (lexicon)
OST440466 (lexicon) OST439841 (lexicon) OST433780 (lexicon) OST430599 (lexicon)
OST428335 (lexicon) OST422673 (lexicon) OST408578 (lexicon) OST405572 (lexicon)
OST403178 (lexicon) OST397517 (lexicon) OST376738 (lexicon) OST373152 (lexicon)
OST363736 (lexicon) OST341995 (lexicon) OST334676 (lexicon) OST286553 (lexicon)
OST283885 (lexicon) OST275585 (lexicon) OST274553 (lexicon) OST254938 (lexicon)
OST243021 (lexicon) OST204254 (lexicon) OST152990 (lexicon) OST139332 (lexicon)
OST134906 (lexicon) OST107786 (lexicon) OST77831 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213763 (Chr8:73201677..73201775 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATGGGGAGACCTACAACG Chr8:73201691..73201710 59.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213763 (Chr8:73201677..73201775 +)
Downstram Exon
ENSMUSE00000213764 (Chr8:73201853..73202033 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATGGGGAGACCTACAACG Chr8:73201691..73201710 59.4 55 CGCACCATGTCAATGATCTC Chr8:73201950..73201969 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682766 Chr8:73197278..73197356 TTATCGCTGCAGGGAAGATG Chr8:73197337..73197356 61.27 50
upstream ENSMUSE00000225998 Chr8:73200454..73200495 TGAAGACAGCGCAGAATCAC Chr8:73200470..73200489 60.14 50
upstream ENSMUSE00000213763 Chr8:73201677..73201775 GAATGGGGAGACCTACAACG Chr8:73201691..73201710 59.4 55

*** Putative Vector Insertion (Chr 8: 73201776 - 73201852) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213764 Chr8:73201853..73202033 CGCACCATGTCAATGATCTC Chr8:73201950..73201969 60.08 50
downstream ENSMUSE00000636306 Chr8:73202259..73202642 AAGTGGGGCTTCACACAAAG Chr8:73202424..73202443 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATGGACTATGCCCGTGAC Chr8:73201813..73201833 62.65 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031848