Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16111
Trapped Gene
Oaz2 (ENSMUSG00000040652)
Vector Insertion
Chr 9: 65524573 - 65534002
Public Clones (sanger) (sanger) (sanger) (ggtc) (ggtc) E041H04 (ggtc)
(ggtc) IST14903F2 (tigm) IST14738G12 (tigm) IST12371B3 (tigm) IST14705H8 (tigm)
IST14329D12 (tigm) IST15049G11 (tigm)
Private Clones OST466477 (lexicon) OST437006 (lexicon) OST421299 (lexicon) OST402713 (lexicon)
OST316215 (lexicon) OST308549 (lexicon) OST297559 (lexicon) OST286578 (lexicon)
OST275143 (lexicon) OST261873 (lexicon) OST260901 (lexicon) OST260729 (lexicon)
OST260701 (lexicon) OST259557 (lexicon) OST252442 (lexicon) OST249415 (lexicon)
OST243916 (lexicon) OST226467 (lexicon) OST215668 (lexicon) OST166196 (lexicon)
OST165319 (lexicon) OST134915 (lexicon) OST129941 (lexicon) OST129405 (lexicon)
OST113895 (lexicon) OST113330 (lexicon) OST98906 (lexicon) OST37360 (lexicon)
OST35346 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000363133 (Chr9:65524397..65524572 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCACCGAGGATGATAAA Chr9:65524541..65524560 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000363133 (Chr9:65524397..65524572 +)
Downstram Exon
ENSMUSE00000409150 (Chr9:65534003..65534078 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCACCGAGGATGATAAA Chr9:65524541..65524560 60.04 50 GGACACTTACTCAACGGCAAA Chr9:65534031..65534051 60.16 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363133 Chr9:65524397..65524572 GAGCCACCGAGGATGATAAA Chr9:65524541..65524560 60.04 50

*** Putative Vector Insertion (Chr 9: 65524573 - 65534002) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409150 Chr9:65534003..65534078 GGACACTTACTCAACGGCAAA Chr9:65534031..65534051 60.16 47.62
downstream ENSMUSE00000346280 Chr9:65534080..65534160 ATCTTCGACAGTGGGTGAGG Chr9:65534108..65534127 60.11 55
downstream ENSMUSE00000246250 Chr9:65535605..65535780 GGAAGTGGACGATGTGAGGT Chr9:65535674..65535693 59.97 55
downstream ENSMUSE00000246230 Chr9:65536628..65536713 CCCTTCCTGAAGCAGATGAA Chr9:65536702..65536721 60.33 50
downstream ENSMUSE00000246214 Chr9:65536902..65538104 AGGCAAGAGCTCTGGTGGTA Chr9:65537775..65537794 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCAGGACTCCCTTGGTAA Chr9:65533607..65533627 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCCAAGCTAGGATGGAGT Chr9:65533530..65533550 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040652