Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16131
Trapped Gene
Srl (ENSMUSG00000022519)
Vector Insertion
Chr 16: 4492390 - 4493778
Public Clones not available
Private Clones OST466184 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000564475 (Chr16:4493779..4493877 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGACAAAACCCTGATGCTG Chr16:4493810..4493829 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000564475 (Chr16:4493779..4493877 -)
Downstram Exon
ENSMUSE00000294616 (Chr16:4492294..4492389 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGACAAAACCCTGATGCTG Chr16:4493810..4493829 59.69 45 GGGCTTGATGGACGTATGAT Chr16:4492321..4492340 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000646115 Chr16:4522993..4523066 CTCCTGCTCTGCTGTTTCCT Chr16:4523022..4523041 59.74 55
upstream ENSMUSE00000127827 Chr16:4496405..4497715 CCTACATGCAGCCTCTGACA Chr16:4496933..4496952 60.01 55
upstream ENSMUSE00000127828 Chr16:4493779..4493880 TTGACAAAACCCTGATGCTG Chr16:4493810..4493829 59.69 45
upstream ENSMUSE00000564475 Chr16:4493779..4493877 TTGACAAAACCCTGATGCTG Chr16:4493810..4493829 59.69 45

*** Putative Vector Insertion (Chr 16: 4492390 - 4493778) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294616 Chr16:4492294..4492389 GGGCTTGATGGACGTATGAT Chr16:4492321..4492340 59.78 50
downstream ENSMUSE00000294611 Chr16:4487493..4487609 ATGGTGGATTTGCCAACACT Chr16:4487521..4487540 60.24 45
downstream ENSMUSE00000294604 Chr16:4486277..4486510 GTGAGAAGGATCGGGCACTA Chr16:4486384..4486403 60.22 55
downstream ENSMUSE00000646113 Chr16:4480214..4483284 CCATGTAGGAGCACTGCTGA Chr16:4482603..4482622 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGATGCTGAATGAGGACA Chr16:4493798..4493818 59.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGATGCTGAATGAGGACA Chr16:4493798..4493818 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022519