Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16132
Trapped Gene
1700016D06Rik (ENSMUSG00000031509)
Vector Insertion
Chr 8: 11665099 - 11678575
Public Clones not available
Private Clones OST466165 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210347 (Chr8:11678576..11678750 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACAGCGAATAGAGGAGCA Chr8:11678649..11678668 59.7 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210347 (Chr8:11678576..11678750 -)
Downstram Exon
ENSMUSE00000210350 (Chr8:11665036..11665098 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACAGCGAATAGAGGAGCA Chr8:11678649..11678668 59.7 50 TTGGCCATTGCTTACCACTT Chr8:11665053..11665072 60.5 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000210347 Chr8:11678576..11678750 TGACAGCGAATAGAGGAGCA Chr8:11678649..11678668 59.7 50

*** Putative Vector Insertion (Chr 8: 11665099 - 11678575) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210350 Chr8:11665036..11665098 TTGGCCATTGCTTACCACTT Chr8:11665053..11665072 60.5 45
downstream ENSMUSE00000210348 Chr8:11662590..11662691 CTTTCCCTGGCTCCAGAATA Chr8:11662631..11662650 59.26 50
downstream ENSMUSE00000210351 Chr8:11661672..11661755 GCATGGTCCCAGAAGATGAC Chr8:11661668..11661687 60.48 55
downstream ENSMUSE00000210352 Chr8:11656109..11656189 CTCCAGAGCTTCAAGGCTTC Chr8:11656118..11656137 59.31 55
downstream ENSMUSE00000375787 Chr8:11654921..11655681 CAGTTCACACAGGTCGATGG Chr8:11655499..11655518 60.15 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTAATCGCCTTGCAGCACA Chr8:11675506..11675526 62.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAATCTCGTGACTGGGAAAACC Chr8:11675508..11675530 60.35 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031509