Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16140
Trapped Gene
Bbs1 (ENSMUSG00000006464)
Vector Insertion
Chr 19: 4895032 - 4897279
Public Clones (cmhd) IST10962F1 (tigm) IST12414E5 (tigm) IST13000E12 (tigm) IST14885E7 (tigm)
IST14477H6 (tigm) IST13097F3 (tigm) IST10962F1 (tigm)
Private Clones OST466095 (lexicon) OST453883 (lexicon) OST403903 (lexicon) OST392935 (lexicon)
OST340830 (lexicon) OST319807 (lexicon) OST310209 (lexicon) OST233267 (lexicon)
OST204701 (lexicon) OST182481 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000442072 (Chr19:4897280..4897438 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000442072 (Chr19:4897280..4897438 -)
Downstram Exon
ENSMUSE00000146185 (Chr19:4894962..4895031 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000553649 Chr19:4906556..4906616 No primer for this exon
upstream ENSMUSE00000553646 Chr19:4906142..4906218 No primer for this exon
upstream ENSMUSE00000622599 Chr19:4905985..4906019 No primer for this exon
upstream ENSMUSE00000485347 Chr19:4903702..4903974 No primer for this exon
upstream ENSMUSE00000622598 Chr19:4903146..4903192 No primer for this exon
upstream ENSMUSE00000146150 Chr19:4903014..4903052 No primer for this exon
upstream ENSMUSE00000146162 Chr19:4902843..4902915 No primer for this exon
upstream ENSMUSE00000359659 Chr19:4900491..4900622 No primer for this exon
upstream ENSMUSE00000146170 Chr19:4899200..4899306 No primer for this exon
upstream ENSMUSE00000146181 Chr19:4897574..4897694 No primer for this exon
upstream ENSMUSE00000442072 Chr19:4897280..4897438 No primer for this exon

*** Putative Vector Insertion (Chr 19: 4895032 - 4897279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146185 Chr19:4894962..4895031 No primer for this exon
downstream ENSMUSE00000146166 Chr19:4894261..4894419 No primer for this exon
downstream ENSMUSE00000146148 Chr19:4892888..4893021 No primer for this exon
downstream ENSMUSE00000146155 Chr19:4891653..4891787 No primer for this exon
downstream ENSMUSE00000146176 Chr19:4890990..4891076 No primer for this exon
downstream ENSMUSE00000553616 Chr19:4886898..4890758 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTCAATGTCATCCATGC Chr19:4897282..4897302 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTCAATGTCATCCATGC Chr19:4897282..4897302 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTGCCAGGGTAAGAAGCTG Chr19:4897425..4897445 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTGCCAGGGTAAGAAGCTG Chr19:4897425..4897445 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006464