Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16142
Trapped Gene
Thoc5 (ENSMUSG00000034274)
Vector Insertion
Chr 11: 4799793 - 4799910
Public Clones not available
Private Clones OST466092 (lexicon) OST212446 (lexicon) OST146357 (lexicon) OST54756 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711275 (Chr11:4799794..4799909 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGTGATCCGGAGTGATGG Chr11:4799847..4799866 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711275 (Chr11:4799794..4799909 +)
Downstram Exon
ENSMUSE00000385865 (Chr11:4799794..4799909 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGTGATCCGGAGTGATGG Chr11:4799847..4799866 59.93 50 CCATCACTCCGGATCACTTT Chr11:4799869..4799888 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682040 Chr11:4795323..4795381 No primer for this exon
upstream ENSMUSE00000342570 Chr11:4795346..4795381 No primer for this exon

*** Putative Vector Insertion (Chr 11: 4799793 - 4799910) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000385865 Chr11:4799794..4799909 CCATCACTCCGGATCACTTT Chr11:4799869..4799888 59.93 50
downstream ENSMUSE00000711275 Chr11:4799794..4799909 CCATCACTCCGGATCACTTT Chr11:4799869..4799888 59.93 50
downstream ENSMUSE00000307519 Chr11:4801155..4801298 GCCATCAGCCTTTGTAGCTC Chr11:4801261..4801280 59.99 55
downstream ENSMUSE00000307513 Chr11:4802089..4802202 CAGCTCTGGATCCTTCGTTC Chr11:4802126..4802145 59.95 55
downstream ENSMUSE00000307507 Chr11:4802338..4802435 GGTAGGCATCGACTTTCTGC Chr11:4802365..4802384 59.84 55
downstream ENSMUSE00000307497 Chr11:4804098..4804244 AGTCCAAACGTGCCAATGTT Chr11:4804225..4804244 60.42 45
downstream ENSMUSE00000307486 Chr11:4805644..4805758 GGAGGCTGCTCAGATAGTCC Chr11:4805735..4805754 58.99 60
downstream ENSMUSE00000307478 Chr11:4810630..4810762 CTGGTCAAATGGCATGAACA Chr11:4810677..4810696 60.52 45
downstream ENSMUSE00000656041 Chr11:4811438..4811473 GCTGGGAGGAGGATTTCATA Chr11:4811464..4811483 59.08 50
downstream ENSMUSE00000307469 Chr11:4812784..4812861 TGAAAAGAGCTTTGGCTTCG Chr11:4812843..4812862 60.63 45
downstream ENSMUSE00000307463 Chr11:4814273..4814313 GTCGTCTGCTCCTCTTCAGC Chr11:4814315..4814334 60.29 60
downstream ENSMUSE00000307456 Chr11:4814525..4814624 CAGACAGTGGGTGCCTTTTT Chr11:4814603..4814622 60.15 50
downstream ENSMUSE00000307447 Chr11:4815492..4815600 CGTCACTTTGGCTTTCACTG Chr11:4815568..4815587 59.49 50
downstream ENSMUSE00000307437 Chr11:4818127..4818228 GATCTCCCGGATACAAGCAG Chr11:4818179..4818198 59.65 55
downstream ENSMUSE00000307427 Chr11:4819736..4819832 ACCCAGCTTCTGTACCCACA Chr11:4819805..4819824 60.57 55
downstream ENSMUSE00000307418 Chr11:4820380..4820494 TCTGTGAGTGGTCAGGCATC Chr11:4820410..4820429 59.83 55
downstream ENSMUSE00000307410 Chr11:4821925..4822028 CCACTTTACCAGGCGAGAAA Chr11:4822004..4822023 60.24 50
downstream ENSMUSE00000307400 Chr11:4822142..4822229 AGTCCTGCCTCCACAATGTC Chr11:4822182..4822201 60.12 55
downstream ENSMUSE00000307394 Chr11:4824751..4824866 TTGTCATCGTTGCTGTTGGT Chr11:4824862..4824881 60.16 45
downstream ENSMUSE00000307387 Chr11:4826049..4826239 GTAGACGTCCAGCAGCACAC Chr11:4826162..4826181 59.5 60
downstream ENSMUSE00000406092 Chr11:4828678..4828868 GACAAGTCGAGGGGAGTCAG Chr11:4828760..4828779 59.83 60
downstream ENSMUSE00000682039 Chr11:4828678..4828870 GACAAGTCGAGGGGAGTCAG Chr11:4828760..4828779 59.83 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCACCTGGAAGCACAATG Chr11:4799798..4799818 59.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCACCTGGAAGCACAATG Chr11:4799798..4799818 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034274